Incidental Mutation 'R4949:Cylc2'
ID383655
Institutional Source Beutler Lab
Gene Symbol Cylc2
Ensembl Gene ENSMUSG00000039555
Gene Namecylicin, basic protein of sperm head cytoskeleton 2
Synonyms4930488P18Rik
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location51216678-51230272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51229804 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 382 (K382R)
Ref Sequence ENSEMBL: ENSMUSP00000125758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041392] [ENSMUST00000166749]
Predicted Effect unknown
Transcript: ENSMUST00000041392
AA Change: K382R
SMART Domains Protein: ENSMUSP00000039750
Gene: ENSMUSG00000039555
AA Change: K382R

DomainStartEndE-ValueType
Pfam:Cylicin_N 7 115 1.1e-43 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156384
Predicted Effect unknown
Transcript: ENSMUST00000166749
AA Change: K382R
SMART Domains Protein: ENSMUSP00000125758
Gene: ENSMUSG00000039555
AA Change: K382R

DomainStartEndE-ValueType
Pfam:Cylicin_N 8 113 4.6e-46 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 338 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Cylc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Cylc2 APN 4 51228157 missense probably damaging 1.00
IGL01669:Cylc2 APN 4 51228360 missense probably benign 0.01
IGL02662:Cylc2 APN 4 51216698 utr 5 prime probably benign
R0277:Cylc2 UTSW 4 51228477 missense unknown
R0323:Cylc2 UTSW 4 51228477 missense unknown
R0968:Cylc2 UTSW 4 51216706 start codon destroyed probably null 0.50
R1395:Cylc2 UTSW 4 51228366 missense possibly damaging 0.53
R1639:Cylc2 UTSW 4 51228310 missense probably benign 0.23
R1643:Cylc2 UTSW 4 51225173 missense probably benign 0.38
R2829:Cylc2 UTSW 4 51229798 missense unknown
R4464:Cylc2 UTSW 4 51229651 missense unknown
R4467:Cylc2 UTSW 4 51229651 missense unknown
R4496:Cylc2 UTSW 4 51229651 missense unknown
R4505:Cylc2 UTSW 4 51229651 missense unknown
R4514:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229840 missense unknown
R4654:Cylc2 UTSW 4 51228279 missense probably benign 0.00
R5141:Cylc2 UTSW 4 51228587 intron probably benign
R5176:Cylc2 UTSW 4 51228587 intron probably benign
R5177:Cylc2 UTSW 4 51228587 intron probably benign
R5179:Cylc2 UTSW 4 51228587 intron probably benign
R7469:Cylc2 UTSW 4 51227970 intron probably null
R7508:Cylc2 UTSW 4 51229256 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACTTTTAAGTACAGCAGCTGAC -3'
(R):5'- GGAGTTCTTACCTTCAGTTTGC -3'

Sequencing Primer
(F):5'- TTTAAGTACAGCAGCTGACAAAGATG -3'
(R):5'- CAGTTTGCTTTTTGAACCAAGACC -3'
Posted On2016-04-27