Incidental Mutation 'R4949:Acox3'
ID383658
Institutional Source Beutler Lab
Gene Symbol Acox3
Ensembl Gene ENSMUSG00000029098
Gene Nameacyl-Coenzyme A oxidase 3, pristanoyl
SynonymsEST-s59, pristanoyl-CoA oxidase, PCOX
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4949 (G1)
Quality Score174
Status Not validated
Chromosome5
Chromosomal Location35583040-35615352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35612106 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 692 (V692A)
Ref Sequence ENSEMBL: ENSMUSP00000109875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068563] [ENSMUST00000068947] [ENSMUST00000114237] [ENSMUST00000114238] [ENSMUST00000202266]
Predicted Effect probably benign
Transcript: ENSMUST00000068563
SMART Domains Protein: ENSMUSP00000067178
Gene: ENSMUSG00000029098

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 3e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 6e-9 PFAM
Pfam:ACOX 507 662 5.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068947
AA Change: V692A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000063412
Gene: ENSMUSG00000029098
AA Change: V692A

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 8.7e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 5.5e-8 PFAM
Pfam:ACOX 510 690 6.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114237
AA Change: V692A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109875
Gene: ENSMUSG00000029098
AA Change: V692A

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 5.7e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 9.4e-9 PFAM
Pfam:ACOX 507 695 1.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114238
SMART Domains Protein: ENSMUSP00000109876
Gene: ENSMUSG00000029098

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 198 309 1.4e-17 PFAM
Pfam:Acyl-CoA_dh_1 340 509 1.3e-7 PFAM
Pfam:ACOX 553 707 1.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154796
Predicted Effect probably benign
Transcript: ENSMUST00000201106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201659
Predicted Effect probably benign
Transcript: ENSMUST00000202266
SMART Domains Protein: ENSMUSP00000144499
Gene: ENSMUSG00000029098

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 4.5e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 3.2e-8 PFAM
Pfam:ACOX 510 667 1.6e-45 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Acox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Acox3 APN 5 35588752 missense probably benign 0.02
IGL02118:Acox3 APN 5 35601521 missense possibly damaging 0.55
IGL02554:Acox3 APN 5 35608366 missense probably damaging 1.00
IGL03377:Acox3 APN 5 35594332 missense probably damaging 1.00
R1543:Acox3 UTSW 5 35603008 missense probably damaging 1.00
R1661:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1665:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1707:Acox3 UTSW 5 35601564 missense possibly damaging 0.87
R1725:Acox3 UTSW 5 35592172 missense probably benign 0.26
R1763:Acox3 UTSW 5 35608339 unclassified probably null
R1851:Acox3 UTSW 5 35609062 missense possibly damaging 0.72
R1923:Acox3 UTSW 5 35592115 missense possibly damaging 0.80
R2154:Acox3 UTSW 5 35605224 missense probably damaging 1.00
R2418:Acox3 UTSW 5 35604638 missense probably benign 0.21
R2892:Acox3 UTSW 5 35594317 missense probably damaging 1.00
R2893:Acox3 UTSW 5 35599848 missense probably benign 0.02
R2894:Acox3 UTSW 5 35599848 missense probably benign 0.02
R2964:Acox3 UTSW 5 35605267 missense possibly damaging 0.81
R3431:Acox3 UTSW 5 35589216 missense possibly damaging 0.47
R3735:Acox3 UTSW 5 35611153 missense probably benign 0.02
R3736:Acox3 UTSW 5 35611153 missense probably benign 0.02
R4106:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4107:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4108:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4579:Acox3 UTSW 5 35604643 missense probably damaging 1.00
R4862:Acox3 UTSW 5 35589739 missense probably benign 0.22
R4903:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4964:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4966:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R5170:Acox3 UTSW 5 35588625 missense probably benign 0.42
R5278:Acox3 UTSW 5 35588156 splice site probably benign
R5569:Acox3 UTSW 5 35603033 missense probably damaging 1.00
R5733:Acox3 UTSW 5 35605199 splice site probably null
R5741:Acox3 UTSW 5 35608324 missense probably benign 0.07
R6530:Acox3 UTSW 5 35588695 missense possibly damaging 0.65
R6580:Acox3 UTSW 5 35608403 missense probably damaging 1.00
R6736:Acox3 UTSW 5 35588854 critical splice donor site probably null
R6848:Acox3 UTSW 5 35592184 missense probably damaging 1.00
R7012:Acox3 UTSW 5 35612087 missense probably benign 0.14
R7233:Acox3 UTSW 5 35605297 missense probably benign 0.01
R7477:Acox3 UTSW 5 35592103 nonsense probably null
R7837:Acox3 UTSW 5 35611486 critical splice acceptor site probably null
R7844:Acox3 UTSW 5 35607148 missense probably benign 0.05
R7920:Acox3 UTSW 5 35611486 critical splice acceptor site probably null
R7927:Acox3 UTSW 5 35607148 missense probably benign 0.05
Z1088:Acox3 UTSW 5 35588222 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAATTTCCTGTTCTCGAGACG -3'
(R):5'- TGTGCAAATCCCTCGCAAATAC -3'

Sequencing Primer
(F):5'- GACGAGAGGACATCACCCTG -3'
(R):5'- CCATTTGAGGATGGGTACAACAG -3'
Posted On2016-04-27