Mutagenetix > Incidental Mutations

Incidental Mutation 'R4949:Rph3a'

383661

Institutional Source

Beutler Lab

Gene Symbol

Rph3a

Ensembl Gene

ENSMUSG00000029608

Gene Name

rabphilin 3A

Synonyms

2900002P20Rik, Doc2 family

MMRRC Submission

042546-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4949 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120940499-121010092 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120963834 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 113 (D113G)

Ref Sequence

ENSEMBL: ENSMUSP00000143917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079204] [ENSMUST00000202326] [ENSMUST00000202406]

Predicted Effect

probably damaging
Transcript: ENSMUST00000079204
AA Change: D113G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078198
Gene: ENSMUSG00000029608
AA Change: D113G

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	44	158	1e-38	PFAM
low complexity region	271	300	N/A	INTRINSIC
low complexity region	347	377	N/A	INTRINSIC
C2	395	500	2.93e-22	SMART
C2	553	667	1.85e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000202326
AA Change: D113G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144291
Gene: ENSMUSG00000029608
AA Change: D113G

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	44	158	1e-38	PFAM
low complexity region	271	300	N/A	INTRINSIC
low complexity region	347	377	N/A	INTRINSIC
C2	395	500	2.93e-22	SMART
C2	553	667	1.85e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000202406
AA Change: D113G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143917
Gene: ENSMUSG00000029608
AA Change: D113G

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	44	158	1e-38	PFAM
low complexity region	271	300	N/A	INTRINSIC
low complexity region	347	377	N/A	INTRINSIC
C2	395	500	2.93e-22	SMART
C2	553	667	1.85e-19	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an effector for RAB3A, which is a small G protein that acts in the late stages of neurotransmitter exocytosis. The encoded protein may be involved in neurotransmitter release and synaptic vesicle traffic. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutants are viable and fertile and do not exhibit any obvious abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933425L06Rik	T	A	13: 105,109,706	S258R	probably damaging	Het
Acox3	T	C	5: 35,612,106	V692A	probably benign	Het
Bcl2l13	G	T	6: 120,887,230	G382W	probably damaging	Het
Cdhr5	T	A	7: 141,272,644	N353I	probably damaging	Het
Chil4	A	G	3: 106,206,092	S170P	possibly damaging	Het
Clp1	A	C	2: 84,723,742	M361R	possibly damaging	Het
Cylc2	A	G	4: 51,229,804	K382R	unknown	Het
Dsg2	T	A	18: 20,590,184	D422E	probably damaging	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Gm14295	A	C	2: 176,809,676	T320P	probably damaging	Het
Ido2	T	G	8: 24,533,954		probably null	Het
Ift140	T	A	17: 25,094,665	S1357T	probably benign	Het
Insr	T	G	8: 3,185,059	E145A	probably benign	Het
Itpripl1	A	G	2: 127,141,407	M265T	probably benign	Het
Kcnb1	G	T	2: 167,105,601	N442K	probably damaging	Het
Kifc5b	C	A	17: 26,925,514	R536S	probably damaging	Het
Klf6	A	T	13: 5,864,948	S129C	probably benign	Het
Lpin2	C	G	17: 71,231,339	P327A	probably damaging	Het
Lsm1	T	C	8: 25,802,037	V114A	probably benign	Het
Map7d1	C	T	4: 126,235,053	W218*	probably null	Het
N4bp2	T	A	5: 65,821,799		probably null	Het
Rheb	A	T	5: 24,803,731	I163K	possibly damaging	Het
Scn8a	A	G	15: 101,029,782	N1381D	probably damaging	Het
Sdsl	T	A	5: 120,459,805	N208Y	possibly damaging	Het
Serpinb9e	A	G	13: 33,251,608	N8S	possibly damaging	Het
Sox18	G	A	2: 181,671,224	Q100*	probably null	Het
Taar8b	C	T	10: 24,091,927	C123Y	probably damaging	Het
Tas2r124	A	G	6: 132,754,895	I56V	possibly damaging	Het
Tes	C	A	6: 17,100,360	H331N	probably benign	Het
Tmbim1	T	G	1: 74,295,365	D12A	probably damaging	Het
Tmprss4	T	C	9: 45,175,543	I307V	possibly damaging	Het
Ttll1	A	T	15: 83,502,173	M77K	probably null	Het
Ttpal	G	A	2: 163,613,751	R220Q	probably damaging	Het
Vmn1r230	T	A	17: 20,847,363	H271Q	probably benign	Het
Vmn2r32	A	G	7: 7,464,084	I815T	probably benign	Het

Other mutations in Rph3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02281:Rph3a	APN	5	120948833	missense	probably damaging	1.00
IGL02383:Rph3a	APN	5	120963939	missense	probably damaging	1.00
IGL02394:Rph3a	APN	5	120946348	splice site	probably null
IGL02429:Rph3a	APN	5	120980124	splice site	probably null
IGL02825:Rph3a	APN	5	120945446	missense	possibly damaging	0.94
R0282:Rph3a	UTSW	5	120963910	nonsense	probably null
R0325:Rph3a	UTSW	5	120943064	missense	probably benign	0.22
R0402:Rph3a	UTSW	5	120942254	missense	probably damaging	0.99
R0648:Rph3a	UTSW	5	120959270	missense	possibly damaging	0.77
R1807:Rph3a	UTSW	5	120945393	missense	probably damaging	0.99
R2273:Rph3a	UTSW	5	120973304	missense	probably damaging	0.98
R2519:Rph3a	UTSW	5	120954422	missense	probably damaging	1.00
R2865:Rph3a	UTSW	5	120947927	missense	probably damaging	1.00
R2939:Rph3a	UTSW	5	120980149	splice site	probably benign
R3153:Rph3a	UTSW	5	120973377	missense	probably damaging	1.00
R4289:Rph3a	UTSW	5	120973305	missense	probably damaging	1.00
R4775:Rph3a	UTSW	5	120954488	missense	probably benign	0.00
R4997:Rph3a	UTSW	5	120963843	missense	probably damaging	0.96
R5008:Rph3a	UTSW	5	120945391	missense	probably damaging	1.00
R5027:Rph3a	UTSW	5	120954449	missense	possibly damaging	0.90
R5155:Rph3a	UTSW	5	120948770	missense	possibly damaging	0.94
R5497:Rph3a	UTSW	5	120942190	missense	probably benign	0.28
R5931:Rph3a	UTSW	5	120963873	missense	probably damaging	0.99
R6273:Rph3a	UTSW	5	120945422	missense	possibly damaging	0.91
R7630:Rph3a	UTSW	5	120943050	missense	probably damaging	1.00
R7664:Rph3a	UTSW	5	120961276	missense	probably benign
R8210:Rph3a	UTSW	5	120961249	missense	probably benign	0.00
R8294:Rph3a	UTSW	5	120961366	missense	probably damaging	1.00
R8445:Rph3a	UTSW	5	120973370	missense	probably damaging	1.00
R8693:Rph3a	UTSW	5	120962438	missense	probably damaging	0.99
R8758:Rph3a	UTSW	5	120959302	missense	probably benign
RF017:Rph3a	UTSW	5	120962499	splice site	probably null
Z1177:Rph3a	UTSW	5	120942266	nonsense	probably null
Z1177:Rph3a	UTSW	5	120961275	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGGGAGACTGAGCATCCTACAC -3'
(R):5'- AGTCTCAAGAATGGAGACTCGG -3'

Sequencing Primer
(F):5'- GGAGACTGAGCATCCTACACAATTC -3'
(R):5'- CTCTCTGCATGGGATACACTGGAG -3'

Posted On

2016-04-27