Incidental Mutation 'R4949:Rph3a'
ID383661
Institutional Source Beutler Lab
Gene Symbol Rph3a
Ensembl Gene ENSMUSG00000029608
Gene Namerabphilin 3A
Synonyms2900002P20Rik, Doc2 family
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120940499-121010092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120963834 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 113 (D113G)
Ref Sequence ENSEMBL: ENSMUSP00000143917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079204] [ENSMUST00000202326] [ENSMUST00000202406]
Predicted Effect probably damaging
Transcript: ENSMUST00000079204
AA Change: D113G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078198
Gene: ENSMUSG00000029608
AA Change: D113G

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202326
AA Change: D113G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144291
Gene: ENSMUSG00000029608
AA Change: D113G

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202406
AA Change: D113G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143917
Gene: ENSMUSG00000029608
AA Change: D113G

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an effector for RAB3A, which is a small G protein that acts in the late stages of neurotransmitter exocytosis. The encoded protein may be involved in neurotransmitter release and synaptic vesicle traffic. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutants are viable and fertile and do not exhibit any obvious abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Rph3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02281:Rph3a APN 5 120948833 missense probably damaging 1.00
IGL02383:Rph3a APN 5 120963939 missense probably damaging 1.00
IGL02394:Rph3a APN 5 120946348 splice site probably null
IGL02429:Rph3a APN 5 120980124 splice site probably null
IGL02825:Rph3a APN 5 120945446 missense possibly damaging 0.94
R0282:Rph3a UTSW 5 120963910 nonsense probably null
R0325:Rph3a UTSW 5 120943064 missense probably benign 0.22
R0402:Rph3a UTSW 5 120942254 missense probably damaging 0.99
R0648:Rph3a UTSW 5 120959270 missense possibly damaging 0.77
R1807:Rph3a UTSW 5 120945393 missense probably damaging 0.99
R2273:Rph3a UTSW 5 120973304 missense probably damaging 0.98
R2519:Rph3a UTSW 5 120954422 missense probably damaging 1.00
R2865:Rph3a UTSW 5 120947927 missense probably damaging 1.00
R2939:Rph3a UTSW 5 120980149 splice site probably benign
R3153:Rph3a UTSW 5 120973377 missense probably damaging 1.00
R4289:Rph3a UTSW 5 120973305 missense probably damaging 1.00
R4775:Rph3a UTSW 5 120954488 missense probably benign 0.00
R4997:Rph3a UTSW 5 120963843 missense probably damaging 0.96
R5008:Rph3a UTSW 5 120945391 missense probably damaging 1.00
R5027:Rph3a UTSW 5 120954449 missense possibly damaging 0.90
R5155:Rph3a UTSW 5 120948770 missense possibly damaging 0.94
R5497:Rph3a UTSW 5 120942190 missense probably benign 0.28
R5931:Rph3a UTSW 5 120963873 missense probably damaging 0.99
R6273:Rph3a UTSW 5 120945422 missense possibly damaging 0.91
R7630:Rph3a UTSW 5 120943050 missense probably damaging 1.00
R7664:Rph3a UTSW 5 120961276 missense probably benign
R8210:Rph3a UTSW 5 120961249 missense not run
RF017:Rph3a UTSW 5 120962499 splice site probably null
Z1177:Rph3a UTSW 5 120942266 nonsense probably null
Z1177:Rph3a UTSW 5 120961275 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGGAGACTGAGCATCCTACAC -3'
(R):5'- AGTCTCAAGAATGGAGACTCGG -3'

Sequencing Primer
(F):5'- GGAGACTGAGCATCCTACACAATTC -3'
(R):5'- CTCTCTGCATGGGATACACTGGAG -3'
Posted On2016-04-27