Incidental Mutation 'R4949:Tes'
ID383662
Institutional Source Beutler Lab
Gene Symbol Tes
Ensembl Gene ENSMUSG00000029552
Gene Nametestis derived transcript
SynonymsD6Ertd352e, Tes1, Tes2, testin, testin2
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17065149-17105828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 17100360 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 331 (H331N)
Ref Sequence ENSEMBL: ENSMUSP00000111127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076654] [ENSMUST00000115467] [ENSMUST00000154266]
Predicted Effect probably benign
Transcript: ENSMUST00000076654
AA Change: H322N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075950
Gene: ENSMUSG00000029552
AA Change: H322N

DomainStartEndE-ValueType
Pfam:PET 82 187 9.6e-46 PFAM
LIM 224 281 9.54e-12 SMART
LIM 289 341 5.35e-15 SMART
LIM 349 404 1.69e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115467
AA Change: H331N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111127
Gene: ENSMUSG00000029552
AA Change: H331N

DomainStartEndE-ValueType
Pfam:PET 96 194 2.1e-44 PFAM
LIM 233 290 9.54e-12 SMART
LIM 298 350 5.35e-15 SMART
LIM 358 413 1.69e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140709
Predicted Effect probably benign
Transcript: ENSMUST00000154266
SMART Domains Protein: ENSMUSP00000118791
Gene: ENSMUSG00000029552

DomainStartEndE-ValueType
Pfam:PET 6 79 4e-33 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cancer-associated chromosomal changes often involve regions containing fragile sites. This gene maps to a commom fragile site on chromosome 7q31.2 designated FRA7G. This gene is similar to mouse Testin, a testosterone-responsive gene encoding a Sertoli cell secretory protein containing three LIM domains. LIM domains are double zinc-finger motifs that mediate protein-protein interactions between transcription factors, cytoskeletal proteins and signaling proteins. This protein is a negative regulator of cell growth and may act as a tumor suppressor. This scaffold protein may also play a role in cell adhesion, cell spreading and in the reorganization of the actin cytoskeleton. Multiple protein isoforms are encoded by transcript variants of this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous and heterozygous null mice display small forestomachs with thickened epithelium and increased tumor incidence and malignancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Tes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Tes APN 6 17099879 missense probably damaging 1.00
IGL02070:Tes APN 6 17099780 missense probably damaging 1.00
R0501:Tes UTSW 6 17097558 missense probably benign
R1591:Tes UTSW 6 17097442 missense probably damaging 0.98
R1777:Tes UTSW 6 17104755 missense probably benign 0.02
R2968:Tes UTSW 6 17096234 missense probably benign 0.00
R3983:Tes UTSW 6 17099701 splice site probably null
R4532:Tes UTSW 6 17097408 missense possibly damaging 0.95
R4893:Tes UTSW 6 17104596 missense probably damaging 1.00
R5026:Tes UTSW 6 17096340 missense probably benign 0.41
R6220:Tes UTSW 6 17086196 nonsense probably null
R6810:Tes UTSW 6 17104652 missense probably benign 0.12
R6903:Tes UTSW 6 17099863 missense probably damaging 0.99
R6987:Tes UTSW 6 17086155 missense probably benign 0.09
R7210:Tes UTSW 6 17104762 missense probably damaging 1.00
R7391:Tes UTSW 6 17096167 missense probably damaging 1.00
R7549:Tes UTSW 6 17099741 frame shift probably null
R7818:Tes UTSW 6 17099744 missense probably damaging 0.99
R8052:Tes UTSW 6 17097292 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGGGACCTGGGTTTGTCAC -3'
(R):5'- CAGATGGCTTTTGAGCTGC -3'

Sequencing Primer
(F):5'- GTTTGTCACTGTGGTGTAAAGAG -3'
(R):5'- GCTGCCTAGATTTAAATAGCCTCTG -3'
Posted On2016-04-27