Incidental Mutation 'R4949:Bcl2l13'
ID383663
Institutional Source Beutler Lab
Gene Symbol Bcl2l13
Ensembl Gene ENSMUSG00000009112
Gene NameBCL2-like 13 (apoptosis facilitator)
SynonymsBCL-RAMBO, Mil1, Mil-1, E430016C20Rik
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4949 (G1)
Quality Score169
Status Not validated
Chromosome6
Chromosomal Location120836212-120892842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120887230 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 382 (G382W)
Ref Sequence ENSEMBL: ENSMUSP00000009256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009256] [ENSMUST00000160684]
Predicted Effect probably damaging
Transcript: ENSMUST00000009256
AA Change: G382W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009256
Gene: ENSMUSG00000009112
AA Change: G382W

DomainStartEndE-ValueType
low complexity region 51 67 N/A INTRINSIC
BCL 106 197 4.19e0 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160684
SMART Domains Protein: ENSMUSP00000125731
Gene: ENSMUSG00000004446

DomainStartEndE-ValueType
Pfam:BID 1 195 3.8e-93 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrially-localized protein with conserved B-cell lymphoma 2 homology motifs. Overexpression of the encoded protein results in apoptosis. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Bcl2l13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02615:Bcl2l13 APN 6 120862867 missense probably damaging 0.98
R1344:Bcl2l13 UTSW 6 120876327 missense probably benign 0.23
R1528:Bcl2l13 UTSW 6 120870794 missense possibly damaging 0.86
R1580:Bcl2l13 UTSW 6 120865714 missense probably benign 0.06
R1743:Bcl2l13 UTSW 6 120848543 nonsense probably null
R5066:Bcl2l13 UTSW 6 120887021 missense possibly damaging 0.86
R5470:Bcl2l13 UTSW 6 120862872 missense probably benign 0.07
R6370:Bcl2l13 UTSW 6 120865622 missense probably benign 0.03
R6843:Bcl2l13 UTSW 6 120848617 critical splice donor site probably null
R6866:Bcl2l13 UTSW 6 120862889 missense probably benign 0.07
R7661:Bcl2l13 UTSW 6 120865597 missense possibly damaging 0.53
R7910:Bcl2l13 UTSW 6 120865685 missense possibly damaging 0.87
R7991:Bcl2l13 UTSW 6 120865685 missense possibly damaging 0.87
R8192:Bcl2l13 UTSW 6 120876306 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTGCTCACACAGGTCCCTAC -3'
(R):5'- TGCTGGCAGTCTAAGTTCCAG -3'

Sequencing Primer
(F):5'- TCCCTACCGTGGAGGCC -3'
(R):5'- CTGGCAGTCTAAGTTCCAGTGAATAC -3'
Posted On2016-04-27