Incidental Mutation 'R4949:Vmn2r32'
ID383665
Institutional Source Beutler Lab
Gene Symbol Vmn2r32
Ensembl Gene ENSMUSG00000096743
Gene Namevomeronasal 2, receptor 32
SynonymsV2r5
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4949 (G1)
Quality Score164
Status Not validated
Chromosome7
Chromosomal Location7463015-7479973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7464084 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 815 (I815T)
Ref Sequence ENSEMBL: ENSMUSP00000092462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094866]
Predicted Effect probably benign
Transcript: ENSMUST00000094866
AA Change: I815T

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092462
Gene: ENSMUSG00000096743
AA Change: I815T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 3.6e-33 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 9.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Other mutations in Vmn2r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Vmn2r32 APN 7 7476697 missense probably damaging 0.97
IGL02333:Vmn2r32 APN 7 7464144 missense probably damaging 1.00
IGL02406:Vmn2r32 APN 7 7476710 missense probably benign
IGL02428:Vmn2r32 APN 7 7474284 missense probably benign 0.02
IGL02484:Vmn2r32 APN 7 7464117 missense probably damaging 1.00
IGL03277:Vmn2r32 APN 7 7474252 missense probably benign 0.23
IGL03366:Vmn2r32 APN 7 7464030 missense probably damaging 0.99
R1055:Vmn2r32 UTSW 7 7474327 nonsense probably null
R1695:Vmn2r32 UTSW 7 7463992 missense probably benign 0.01
R2172:Vmn2r32 UTSW 7 7474615 missense probably damaging 0.99
R2262:Vmn2r32 UTSW 7 7474619 missense probably benign
R3150:Vmn2r32 UTSW 7 7472555 missense probably benign
R4362:Vmn2r32 UTSW 7 7479858 nonsense probably null
R4432:Vmn2r32 UTSW 7 7479919 missense probably damaging 0.98
R4851:Vmn2r32 UTSW 7 7479954 missense possibly damaging 0.59
R5990:Vmn2r32 UTSW 7 7479810 missense probably damaging 0.97
R6083:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6084:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6116:Vmn2r32 UTSW 7 7464093 missense probably damaging 1.00
R6263:Vmn2r32 UTSW 7 7476692 missense possibly damaging 0.90
R6889:Vmn2r32 UTSW 7 7472574 missense possibly damaging 0.82
R7286:Vmn2r32 UTSW 7 7479808 missense probably benign 0.21
R7390:Vmn2r32 UTSW 7 7479852 missense probably benign 0.00
R7412:Vmn2r32 UTSW 7 7474213 missense possibly damaging 0.53
R7508:Vmn2r32 UTSW 7 7467374 missense possibly damaging 0.87
Z1177:Vmn2r32 UTSW 7 7474161 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTTATCACTAGAGCAACCAGTGAG -3'
(R):5'- CACTGGGAAGCTTCACTTTGG -3'

Sequencing Primer
(F):5'- CTAGAGCAACCAGTGAGAGTGATTC -3'
(R):5'- GGAAGCTTCACTTTGGCTTTC -3'
Posted On2016-04-27