Incidental Mutation 'R4949:Insr'
ID383668
Institutional Source Beutler Lab
Gene Symbol Insr
Ensembl Gene ENSMUSG00000005534
Gene Nameinsulin receptor
SynonymsIR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3122061-3279617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3185059 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 145 (E145A)
Ref Sequence ENSEMBL: ENSMUSP00000146818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091291] [ENSMUST00000207100]
Predicted Effect probably benign
Transcript: ENSMUST00000091291
AA Change: E710A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: E710A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Recep_L_domain 52 164 5e-28 PFAM
FU 231 274 1.66e-10 SMART
Pfam:Recep_L_domain 359 473 2.5e-30 PFAM
FN3 496 602 4.02e1 SMART
FN3 624 821 1.16e-6 SMART
FN3 841 924 3.17e-4 SMART
transmembrane domain 947 969 N/A INTRINSIC
TyrKc 1013 1280 3.11e-134 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1327 1336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207100
AA Change: E145A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207295
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Insr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Insr APN 8 3258682 missense probably damaging 1.00
IGL01986:Insr APN 8 3158817 missense probably damaging 1.00
IGL02135:Insr APN 8 3258741 missense probably damaging 1.00
IGL02203:Insr APN 8 3155817 missense probably benign 0.18
IGL02220:Insr APN 8 3159578 missense probably damaging 1.00
IGL02678:Insr APN 8 3173570 missense probably benign 0.00
IGL02961:Insr APN 8 3258785 missense probably benign 0.08
IGL03099:Insr APN 8 3258715 missense probably damaging 1.00
IGL03125:Insr APN 8 3184972 missense possibly damaging 0.87
IGL03290:Insr APN 8 3258574 missense probably damaging 1.00
gummi_bear UTSW 8 3161770 missense probably damaging 1.00
Patently UTSW 8 3159475 missense probably damaging 1.00
trolli UTSW 8 3198111 missense probably benign 0.31
R0047:Insr UTSW 8 3202947 missense probably damaging 0.97
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0480:Insr UTSW 8 3161770 missense probably damaging 1.00
R0748:Insr UTSW 8 3258841 missense probably damaging 1.00
R0919:Insr UTSW 8 3158769 missense probably damaging 1.00
R1348:Insr UTSW 8 3192635 missense probably damaging 1.00
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1568:Insr UTSW 8 3165576 missense probably benign
R1768:Insr UTSW 8 3159561 missense probably damaging 1.00
R2093:Insr UTSW 8 3204762 missense probably damaging 1.00
R2111:Insr UTSW 8 3169748 missense probably benign 0.17
R2112:Insr UTSW 8 3169748 missense probably benign 0.17
R2352:Insr UTSW 8 3192593 missense probably damaging 1.00
R2364:Insr UTSW 8 3174820 missense probably benign
R2842:Insr UTSW 8 3202986 missense probably damaging 1.00
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R4081:Insr UTSW 8 3211391 missense probably benign 0.00
R4441:Insr UTSW 8 3194902 missense probably benign 0.00
R4672:Insr UTSW 8 3167501 critical splice donor site probably null
R4687:Insr UTSW 8 3161709 missense probably benign 0.42
R4708:Insr UTSW 8 3211346 intron probably benign
R4890:Insr UTSW 8 3198234 missense probably benign 0.16
R4996:Insr UTSW 8 3192665 missense probably null 0.98
R5073:Insr UTSW 8 3159475 missense probably damaging 1.00
R5176:Insr UTSW 8 3158742 missense probably benign 0.03
R5200:Insr UTSW 8 3198059 critical splice donor site probably null
R5323:Insr UTSW 8 3202902 missense probably benign 0.02
R5453:Insr UTSW 8 3155694 missense probably benign 0.06
R5516:Insr UTSW 8 3155764 nonsense probably null
R5704:Insr UTSW 8 3185122 missense possibly damaging 0.52
R5820:Insr UTSW 8 3155976 missense probably damaging 1.00
R5879:Insr UTSW 8 3198173 nonsense probably null
R5894:Insr UTSW 8 3174869 missense possibly damaging 0.88
R5937:Insr UTSW 8 3174808 missense probably benign
R5966:Insr UTSW 8 3258697 missense probably benign 0.04
R6134:Insr UTSW 8 3192572 missense probably damaging 1.00
R6352:Insr UTSW 8 3173479 critical splice donor site probably null
R6423:Insr UTSW 8 3173566 missense probably benign
R6687:Insr UTSW 8 3198111 missense probably benign 0.31
R6985:Insr UTSW 8 3161372 missense possibly damaging 0.87
R6993:Insr UTSW 8 3258752 missense probably damaging 1.00
R7041:Insr UTSW 8 3258418 missense probably benign
R7109:Insr UTSW 8 3258481 missense probably benign 0.33
R7216:Insr UTSW 8 3203034 missense possibly damaging 0.53
R7287:Insr UTSW 8 3169717 missense probably benign 0.00
R7378:Insr UTSW 8 3198231 missense probably damaging 1.00
R7525:Insr UTSW 8 3192642 missense probably damaging 1.00
R7572:Insr UTSW 8 3173602 missense probably benign 0.11
R7636:Insr UTSW 8 3258709 missense probably damaging 1.00
R7684:Insr UTSW 8 3169753 missense possibly damaging 0.85
R7840:Insr UTSW 8 3258415 missense probably benign 0.04
R7923:Insr UTSW 8 3258415 missense probably benign 0.04
R8075:Insr UTSW 8 3155862 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAAGAAGTCATGGCACCAAGC -3'
(R):5'- ACCGAGAAAGCACTGTGGTG -3'

Sequencing Primer
(F):5'- GTCATGGCACCAAGCTAACAG -3'
(R):5'- CACTGTGGTGCTGTGTGTG -3'
Posted On2016-04-27