Incidental Mutation 'R4949:Ido2'
ID383669
Institutional Source Beutler Lab
Gene Symbol Ido2
Ensembl Gene ENSMUSG00000031549
Gene Nameindoleamine 2,3-dioxygenase 2
SynonymsIndol1, C230043N17Rik, Ido2
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24531892-24576333 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 24533954 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121992]
Predicted Effect probably null
Transcript: ENSMUST00000121992
SMART Domains Protein: ENSMUSP00000113979
Gene: ENSMUSG00000031549

DomainStartEndE-ValueType
Pfam:IDO 15 399 1.4e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140417
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Along with the enzymes encoded by the INDO (MIM 147435) and TDO2 (MIM 191070) genes, the enzyme encoded by the INDOL1 gene metabolizes tryptophan in the kynurenine pathway (Ball et al., 2007 [PubMed 17499941]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell function and decreased susceptibility to type IV hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Ido2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0413:Ido2 UTSW 8 24558143 splice site probably null
R1103:Ido2 UTSW 8 24576223 missense probably benign 0.08
R1601:Ido2 UTSW 8 24576189 missense possibly damaging 0.57
R1868:Ido2 UTSW 8 24553760 missense possibly damaging 0.90
R2158:Ido2 UTSW 8 24540636 missense probably damaging 1.00
R2266:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2267:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2268:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2484:Ido2 UTSW 8 24533815 missense probably damaging 1.00
R3151:Ido2 UTSW 8 24533760 missense possibly damaging 0.61
R3735:Ido2 UTSW 8 24535193 missense probably damaging 0.98
R3820:Ido2 UTSW 8 24533755 missense probably benign 0.00
R3821:Ido2 UTSW 8 24533755 missense probably benign 0.00
R3822:Ido2 UTSW 8 24533755 missense probably benign 0.00
R4520:Ido2 UTSW 8 24576178 missense probably damaging 0.99
R4824:Ido2 UTSW 8 24533859 missense probably benign 0.12
R5235:Ido2 UTSW 8 24547186 missense probably damaging 0.99
R5580:Ido2 UTSW 8 24550866 missense possibly damaging 0.67
R5961:Ido2 UTSW 8 24533770 missense probably damaging 1.00
R6433:Ido2 UTSW 8 24533923 missense probably damaging 1.00
R7085:Ido2 UTSW 8 24558196 missense probably benign 0.09
R7186:Ido2 UTSW 8 24550810 synonymous probably null
R7248:Ido2 UTSW 8 24540641 nonsense probably null
R7248:Ido2 UTSW 8 24548823 missense probably damaging 0.97
R7287:Ido2 UTSW 8 24535138 splice site probably null
R7788:Ido2 UTSW 8 24547226 missense probably damaging 0.99
R8026:Ido2 UTSW 8 24535140 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGATGTGGTAACTGCGCAG -3'
(R):5'- CACGGAGCAGTAGATTTCTGTCC -3'

Sequencing Primer
(F):5'- AGCTCTCCCAGGGCCTC -3'
(R):5'- CCTGTGTCTCCTGTCAACAAC -3'
Posted On2016-04-27