Incidental Mutation 'R0333:Tctn3'
ID38367
Institutional Source Beutler Lab
Gene Symbol Tctn3
Ensembl Gene ENSMUSG00000025008
Gene Nametectonic family member 3
Synonyms4930521E07Rik, Tect3
MMRRC Submission 038542-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0333 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40596446-40612233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40607267 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 358 (L358H)
Ref Sequence ENSEMBL: ENSMUSP00000121760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025981] [ENSMUST00000132452] [ENSMUST00000135795]
Predicted Effect probably benign
Transcript: ENSMUST00000025981
SMART Domains Protein: ENSMUSP00000025981
Gene: ENSMUSG00000025008

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 6.3e-83 PFAM
low complexity region 578 590 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132452
AA Change: L358H

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121760
Gene: ENSMUSG00000025008
AA Change: L358H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 364 3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135795
SMART Domains Protein: ENSMUSP00000123461
Gene: ENSMUSG00000025008

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 2.5e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144566
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 T C 9: 106,241,281 N214S probably benign Het
Antxr1 A G 6: 87,188,838 probably benign Het
Atxn7l3 A T 11: 102,294,992 probably null Het
Cab39l A G 14: 59,499,611 E60G probably damaging Het
Cdc5l G T 17: 45,393,216 probably benign Het
Cux2 T C 5: 121,860,608 E1423G probably benign Het
Dbndd1 G T 8: 123,506,773 Q165K probably damaging Het
Drd1 C A 13: 54,054,063 C37F probably damaging Het
Elp3 G A 14: 65,590,593 P11L probably benign Het
F830045P16Rik A G 2: 129,472,857 Y167H probably damaging Het
Gimap3 G A 6: 48,765,730 Q89* probably null Het
Herc1 G A 9: 66,464,699 probably null Het
Hist3h2a C A 11: 58,954,859 S41* probably null Het
Ipo11 A G 13: 106,870,763 V603A probably benign Het
Kifap3 G A 1: 163,797,264 A130T probably damaging Het
Klhl23 A G 2: 69,833,897 Y530C probably damaging Het
Map4k1 C T 7: 28,999,761 probably benign Het
Mroh2b T A 15: 4,931,118 L778M probably damaging Het
Mtdh T C 15: 34,118,101 S344P possibly damaging Het
Ncoa3 T G 2: 166,054,291 N371K probably damaging Het
Ncor2 C A 5: 125,034,344 probably benign Het
Nrn1l A G 8: 105,894,420 E48G probably benign Het
Nudcd1 A G 15: 44,401,287 I271T probably benign Het
Olfr23 A T 11: 73,940,767 I174F possibly damaging Het
Olfr31 T C 14: 14,328,498 L129P probably damaging Het
Pard3b A G 1: 62,230,212 N653S probably benign Het
Park2 T C 17: 11,067,140 F6L probably damaging Het
Plekhg1 A C 10: 3,964,419 K1380N probably damaging Het
Ppara T A 15: 85,790,960 I210N probably damaging Het
Ppp2r5b A G 19: 6,229,047 probably benign Het
Prr14l A G 5: 32,827,993 L1386P probably damaging Het
Ralgapa1 A G 12: 55,782,900 probably benign Het
Reln A T 5: 21,929,242 L2563I probably damaging Het
Rps7 A G 12: 28,631,201 probably benign Het
Rslcan18 T C 13: 67,098,622 K309E probably damaging Het
Sec14l5 C T 16: 5,167,066 T92M probably damaging Het
Slc22a8 G A 19: 8,608,150 probably benign Het
Smad2 G A 18: 76,262,621 A44T probably damaging Het
Smcr8 T C 11: 60,780,222 V732A possibly damaging Het
Spata2l A G 8: 123,233,632 F306S probably damaging Het
Stab2 T C 10: 86,841,627 D2552G probably benign Het
Tk2 C T 8: 104,248,514 probably benign Het
Tm6sf2 C T 8: 70,077,914 R215C probably damaging Het
Tmbim6 T C 15: 99,406,674 I204T probably damaging Het
Tubgcp2 C A 7: 139,999,347 W675C probably damaging Het
Usp48 T A 4: 137,594,483 I62N probably damaging Het
Vmn2r74 T C 7: 85,952,283 T716A probably benign Het
Vps13b C A 15: 35,879,803 T3008K probably damaging Het
Wnk1 G A 6: 119,928,163 probably benign Het
Other mutations in Tctn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Tctn3 APN 19 40597421 missense probably damaging 0.99
IGL01326:Tctn3 APN 19 40597436 missense probably damaging 1.00
IGL01351:Tctn3 APN 19 40607637 missense probably benign 0.00
IGL01604:Tctn3 APN 19 40605302 splice site probably null
IGL01844:Tctn3 APN 19 40612137 missense probably damaging 0.99
IGL02469:Tctn3 APN 19 40597523 missense probably benign 0.01
FR4449:Tctn3 UTSW 19 40607202 intron probably benign
R0409:Tctn3 UTSW 19 40611416 splice site probably benign
R1573:Tctn3 UTSW 19 40608917 nonsense probably null
R2288:Tctn3 UTSW 19 40605713 missense probably damaging 1.00
R3792:Tctn3 UTSW 19 40611711 missense probably benign 0.00
R3916:Tctn3 UTSW 19 40607649 missense possibly damaging 0.68
R4033:Tctn3 UTSW 19 40597323 missense probably benign 0.23
R4728:Tctn3 UTSW 19 40605742 missense probably damaging 1.00
R5093:Tctn3 UTSW 19 40612104 missense probably damaging 0.99
R5253:Tctn3 UTSW 19 40607241 missense probably benign 0.25
R5334:Tctn3 UTSW 19 40602822 missense probably benign 0.16
R5620:Tctn3 UTSW 19 40608917 nonsense probably null
R6143:Tctn3 UTSW 19 40609227 missense probably benign 0.03
R6166:Tctn3 UTSW 19 40597479 missense possibly damaging 0.92
R7629:Tctn3 UTSW 19 40611336 missense probably damaging 1.00
R8137:Tctn3 UTSW 19 40605341 missense probably damaging 1.00
R8712:Tctn3 UTSW 19 40611726 missense probably damaging 1.00
R8762:Tctn3 UTSW 19 40607192 missense unknown
Z1088:Tctn3 UTSW 19 40607346 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACTGAGCACAGTGAGCAGCTTTAAC -3'
(R):5'- CAGCAAGCCCACGCTATTTTGG -3'

Sequencing Primer
(F):5'- GCGTACTGAGTATCTGCCAC -3'
(R):5'- AGCCCACGCTATTTTGGTTAATG -3'
Posted On2013-05-23