Incidental Mutation 'R4949:Tmprss4'
ID383672
Institutional Source Beutler Lab
Gene Symbol Tmprss4
Ensembl Gene ENSMUSG00000032091
Gene Nametransmembrane protease, serine 4
Synonyms
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45172726-45204092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45175543 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 307 (I307V)
Ref Sequence ENSEMBL: ENSMUSP00000131890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034599] [ENSMUST00000165263] [ENSMUST00000170069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034599
AA Change: I307V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034599
Gene: ENSMUSG00000032091
AA Change: I307V

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
LDLa 52 92 1.55e-2 SMART
SR 102 192 2.51e-7 SMART
Tryp_SPc 202 427 9.03e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163945
Predicted Effect possibly damaging
Transcript: ENSMUST00000165263
AA Change: I307V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131890
Gene: ENSMUSG00000032091
AA Change: I307V

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
LDLa 52 92 1.55e-2 SMART
SR 102 192 2.51e-7 SMART
Tryp_SPc 202 335 2.26e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166780
Predicted Effect probably benign
Transcript: ENSMUST00000170069
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine protease family. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified as a gene overexpressed in pancreatic carcinoma. The encoded protein is membrane bound with a N-terminal anchor sequence and a glycosylated extracellular region containing the serine protease domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele appear healthy and response normally to a sodium-deficient diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Tmprss4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Tmprss4 APN 9 45179420 missense probably damaging 1.00
R0153:Tmprss4 UTSW 9 45184336 missense probably benign 0.01
R1445:Tmprss4 UTSW 9 45184385 missense possibly damaging 0.59
R2359:Tmprss4 UTSW 9 45185832 missense probably benign
R3918:Tmprss4 UTSW 9 45180666 missense probably benign 0.13
R3919:Tmprss4 UTSW 9 45180666 missense probably benign 0.13
R4655:Tmprss4 UTSW 9 45176404 missense probably benign
R4976:Tmprss4 UTSW 9 45173408 missense possibly damaging 0.86
R5177:Tmprss4 UTSW 9 45173962 missense probably benign 0.09
R5918:Tmprss4 UTSW 9 45175116 nonsense probably null
R6922:Tmprss4 UTSW 9 45185922 missense probably benign
R7091:Tmprss4 UTSW 9 45184273 missense probably damaging 0.97
R7488:Tmprss4 UTSW 9 45175555 missense probably benign 0.03
X0058:Tmprss4 UTSW 9 45177833 missense probably damaging 1.00
Z1088:Tmprss4 UTSW 9 45175465 missense probably damaging 0.98
Z1177:Tmprss4 UTSW 9 45176519 missense probably benign 0.44
Z1177:Tmprss4 UTSW 9 45184241 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACTTTGGTGCCTGGTCAGTC -3'
(R):5'- ACAAGGAACCTAGCATTTTCTGG -3'

Sequencing Primer
(F):5'- CAGTCAGGGTGGACTTTTCTGAAG -3'
(R):5'- GCTTGAGAATAACTGTCTAGCCTGC -3'
Posted On2016-04-27