Incidental Mutation 'R4949:Taar8b'
ID383674
Institutional Source Beutler Lab
Gene Symbol Taar8b
Ensembl Gene ENSMUSG00000100186
Gene Nametrace amine-associated receptor 8B
SynonymsLOC382348
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24091260-24092294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24091927 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 123 (C123Y)
Ref Sequence ENSEMBL: ENSMUSP00000090324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092654]
Predicted Effect probably damaging
Transcript: ENSMUST00000092654
AA Change: C123Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090324
Gene: ENSMUSG00000100186
AA Change: C123Y

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 39 244 1.4e-8 PFAM
Pfam:7TM_GPCR_Srsx 42 327 1.1e-14 PFAM
Pfam:7tm_1 48 312 6.4e-57 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Taar8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Taar8b APN 10 24091756 missense possibly damaging 0.69
IGL01380:Taar8b APN 10 24092107 missense probably damaging 1.00
IGL01536:Taar8b APN 10 24091595 missense probably benign
IGL02192:Taar8b APN 10 24091364 missense probably damaging 1.00
IGL02282:Taar8b APN 10 24091555 missense possibly damaging 0.83
R0730:Taar8b UTSW 10 24092026 missense probably damaging 1.00
R1871:Taar8b UTSW 10 24092002 missense probably damaging 1.00
R2051:Taar8b UTSW 10 24091314 missense probably benign 0.38
R2265:Taar8b UTSW 10 24091372 missense probably damaging 0.99
R2267:Taar8b UTSW 10 24091372 missense probably damaging 0.99
R2268:Taar8b UTSW 10 24091372 missense probably damaging 0.99
R2269:Taar8b UTSW 10 24091372 missense probably damaging 0.99
R4598:Taar8b UTSW 10 24091838 missense probably benign
R4633:Taar8b UTSW 10 24092252 nonsense probably null
R4833:Taar8b UTSW 10 24092132 missense possibly damaging 0.77
R6104:Taar8b UTSW 10 24092237 missense probably damaging 1.00
R6178:Taar8b UTSW 10 24091813 missense probably benign 0.01
R6495:Taar8b UTSW 10 24091262 makesense probably null
R6816:Taar8b UTSW 10 24092181 missense probably benign 0.00
R6913:Taar8b UTSW 10 24092065 missense possibly damaging 0.95
R7072:Taar8b UTSW 10 24091978 missense possibly damaging 0.95
R7691:Taar8b UTSW 10 24091538 nonsense probably null
R8082:Taar8b UTSW 10 24091891 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCACTTACTAAGCTTTCAATCCC -3'
(R):5'- ACCTCCTGGTGGTGATTTCAG -3'

Sequencing Primer
(F):5'- TCAATCCCCTTAGCACTGATG -3'
(R):5'- AGTTCTCCATTTCAAGCAGCTG -3'
Posted On2016-04-27