Incidental Mutation 'R4949:Serpinb9e'
ID383679
Institutional Source Beutler Lab
Gene Symbol Serpinb9e
Ensembl Gene ENSMUSG00000062342
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9e
SynonymsSpi14, ovalbumin, NK26
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33249612-33260850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33251608 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 8 (N8S)
Ref Sequence ENSEMBL: ENSMUSP00000071769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071873]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071873
AA Change: N8S

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071769
Gene: ENSMUSG00000062342
AA Change: N8S

DomainStartEndE-ValueType
SERPIN 13 377 1.82e-168 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Serpinb9e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Serpinb9e APN 13 33255125 missense probably damaging 0.97
IGL02352:Serpinb9e APN 13 33257820 splice site probably benign
IGL02359:Serpinb9e APN 13 33257820 splice site probably benign
IGL02604:Serpinb9e APN 13 33257759 missense probably benign 0.00
IGL02859:Serpinb9e APN 13 33251650 missense possibly damaging 0.83
R0257:Serpinb9e UTSW 13 33257681 missense probably benign 0.24
R0751:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1101:Serpinb9e UTSW 13 33260088 missense probably benign 0.10
R1170:Serpinb9e UTSW 13 33257752 nonsense probably null
R1184:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1253:Serpinb9e UTSW 13 33255119 missense possibly damaging 0.77
R1405:Serpinb9e UTSW 13 33260026 missense probably benign
R1405:Serpinb9e UTSW 13 33260026 missense probably benign
R1463:Serpinb9e UTSW 13 33255116 missense probably benign
R1566:Serpinb9e UTSW 13 33253494 missense probably damaging 1.00
R1924:Serpinb9e UTSW 13 33253445 missense probably benign 0.07
R1964:Serpinb9e UTSW 13 33253491 missense probably benign 0.04
R2153:Serpinb9e UTSW 13 33252978 missense probably damaging 1.00
R2405:Serpinb9e UTSW 13 33260080 missense probably benign
R2972:Serpinb9e UTSW 13 33255143 missense probably benign
R2973:Serpinb9e UTSW 13 33255143 missense probably benign
R2974:Serpinb9e UTSW 13 33255143 missense probably benign
R3854:Serpinb9e UTSW 13 33255154 missense probably benign 0.40
R4173:Serpinb9e UTSW 13 33255158 missense probably damaging 0.97
R4937:Serpinb9e UTSW 13 33252952 missense probably benign 0.11
R5347:Serpinb9e UTSW 13 33257784 missense probably damaging 1.00
R5976:Serpinb9e UTSW 13 33255129 missense probably benign
R5979:Serpinb9e UTSW 13 33255053 missense probably benign 0.18
R5991:Serpinb9e UTSW 13 33259807 missense probably damaging 1.00
R6059:Serpinb9e UTSW 13 33257774 missense probably benign 0.29
R6884:Serpinb9e UTSW 13 33251626 missense probably benign 0.33
R8007:Serpinb9e UTSW 13 33251622 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CACAGAAGCTAGTTTGTGTTCCTG -3'
(R):5'- GGGTATGGTTTCACAGGGAAC -3'

Sequencing Primer
(F):5'- AGTTTGTGTTCCTGCTATGATCAAC -3'
(R):5'- GGGAACTTACCTGACATATCTGGAC -3'
Posted On2016-04-27