Incidental Mutation 'R4949:4933425L06Rik'
ID383680
Institutional Source Beutler Lab
Gene Symbol 4933425L06Rik
Ensembl Gene ENSMUSG00000021718
Gene NameRIKEN cDNA 4933425L06 gene
Synonyms
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location105082122-105121782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105109706 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 258 (S258R)
Ref Sequence ENSEMBL: ENSMUSP00000022232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022232]
Predicted Effect probably damaging
Transcript: ENSMUST00000022232
AA Change: S258R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022232
Gene: ENSMUSG00000021718
AA Change: S258R

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Metallophos 40 245 4.8e-12 PFAM
Pfam:5_nucleotid_C 314 472 4.1e-42 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in 4933425L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:4933425L06Rik APN 13 105118684 missense probably damaging 1.00
IGL01099:4933425L06Rik APN 13 105109360 missense probably benign 0.00
IGL01540:4933425L06Rik APN 13 105082253 missense possibly damaging 0.47
IGL01968:4933425L06Rik APN 13 105119830 missense probably damaging 0.98
IGL02364:4933425L06Rik APN 13 105082300 missense probably damaging 1.00
IGL02447:4933425L06Rik APN 13 105100459 missense probably damaging 0.99
R0534:4933425L06Rik UTSW 13 105082254 nonsense probably null
R1486:4933425L06Rik UTSW 13 105109783 missense probably benign 0.26
R1543:4933425L06Rik UTSW 13 105112369 nonsense probably null
R1544:4933425L06Rik UTSW 13 105109621 missense probably benign 0.00
R1631:4933425L06Rik UTSW 13 105082241 missense probably benign
R1807:4933425L06Rik UTSW 13 105082236 missense probably benign
R1835:4933425L06Rik UTSW 13 105082194 missense unknown
R2427:4933425L06Rik UTSW 13 105109761 missense probably benign 0.03
R2504:4933425L06Rik UTSW 13 105109742 missense probably benign 0.09
R4353:4933425L06Rik UTSW 13 105118745 missense probably benign 0.14
R6242:4933425L06Rik UTSW 13 105109540 missense probably benign 0.00
R6376:4933425L06Rik UTSW 13 105119965 missense possibly damaging 0.95
R6615:4933425L06Rik UTSW 13 105112485 missense probably damaging 1.00
R7610:4933425L06Rik UTSW 13 105111187 missense probably damaging 1.00
R7773:4933425L06Rik UTSW 13 105082285 missense probably damaging 1.00
R8171:4933425L06Rik UTSW 13 105109783 missense probably benign 0.26
X0024:4933425L06Rik UTSW 13 105112511 missense probably damaging 0.99
X0057:4933425L06Rik UTSW 13 105082251 missense probably benign
Z1176:4933425L06Rik UTSW 13 105111144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGAGCTAGCCGTGGAGC -3'
(R):5'- CTATGATGTGGTCTACAATGCTGTC -3'

Sequencing Primer
(F):5'- TAGCCGTGGAGCTCCGAG -3'
(R):5'- CAATGCTGTCTAAAATGTCCGTG -3'
Posted On2016-04-27