Incidental Mutation 'R4949:Vmn1r230'
ID383683
Institutional Source Beutler Lab
Gene Symbol Vmn1r230
Ensembl Gene ENSMUSG00000045417
Gene Namevomeronasal 1 receptor 230
SynonymsV1re8
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20846551-20847501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20847363 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 271 (H271Q)
Ref Sequence ENSEMBL: ENSMUSP00000061330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053974]
Predicted Effect probably benign
Transcript: ENSMUST00000053974
AA Change: H271Q

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000061330
Gene: ENSMUSG00000045417
AA Change: H271Q

DomainStartEndE-ValueType
Pfam:TAS2R 20 315 2.4e-12 PFAM
Pfam:V1R 50 312 7.9e-30 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Vmn1r230
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02590:Vmn1r230 APN 17 20846910 missense probably damaging 1.00
IGL03004:Vmn1r230 APN 17 20847510 unclassified probably benign
R0306:Vmn1r230 UTSW 17 20846633 missense possibly damaging 0.93
R0318:Vmn1r230 UTSW 17 20846816 missense possibly damaging 0.91
R2076:Vmn1r230 UTSW 17 20846882 missense probably damaging 0.99
R2151:Vmn1r230 UTSW 17 20846801 missense probably damaging 0.99
R2153:Vmn1r230 UTSW 17 20846801 missense probably damaging 0.99
R2154:Vmn1r230 UTSW 17 20846801 missense probably damaging 0.99
R2192:Vmn1r230 UTSW 17 20847093 missense probably benign 0.05
R2215:Vmn1r230 UTSW 17 20847422 missense probably benign 0.25
R2309:Vmn1r230 UTSW 17 20847230 missense probably damaging 1.00
R4493:Vmn1r230 UTSW 17 20846601 missense probably benign
R4683:Vmn1r230 UTSW 17 20847253 missense probably benign 0.07
R4804:Vmn1r230 UTSW 17 20847083 missense probably damaging 0.99
R5138:Vmn1r230 UTSW 17 20846968 nonsense probably null
R6248:Vmn1r230 UTSW 17 20846774 missense possibly damaging 0.82
R7329:Vmn1r230 UTSW 17 20846690 missense probably damaging 1.00
R7468:Vmn1r230 UTSW 17 20846884 missense probably damaging 1.00
R7716:Vmn1r230 UTSW 17 20846882 missense possibly damaging 0.68
R7817:Vmn1r230 UTSW 17 20846561 missense probably benign 0.00
R7832:Vmn1r230 UTSW 17 20846671 missense probably benign 0.00
R7915:Vmn1r230 UTSW 17 20846671 missense probably benign 0.00
U24488:Vmn1r230 UTSW 17 20846752 missense probably benign 0.01
Z1176:Vmn1r230 UTSW 17 20846952 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCAGGTAGCTCAGTGATTGTC -3'
(R):5'- CCTGTATAATGTCTTCTCCAAAGCATG -3'

Sequencing Primer
(F):5'- GTCATTCTGTATAGGCACAAACAGC -3'
(R):5'- CTGGACTCTTCAAAAGCATTCAAAG -3'
Posted On2016-04-27