Mutagenetix > Incidental Mutation

Incidental Mutation 'R4963:Tpp2'

383690

Institutional Source

Beutler Lab

Gene Symbol

Tpp2

Ensembl Gene

ENSMUSG00000041763

Gene Name

tripeptidyl peptidase II

Synonyms

TppII

MMRRC Submission

042560-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.478) question?

Stock #

R4963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43933647-44003000 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43992268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1069 (R1069Q)

Ref Sequence

ENSEMBL: ENSMUSP00000139918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388] [ENSMUST00000190207]

AlphaFold

Q64514

Predicted Effect

probably damaging
Transcript: ENSMUST00000087933
AA Change: R1082Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: R1082Q

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	35	500	1.4e-96	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	777	964	2.4e-80	PFAM
low complexity region	1017	1033	N/A	INTRINSIC
PDB:3LXU\|X	1034	1262	1e-20	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000188302

SMART Domains

Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	4.3e-84	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000188313
AA Change: R1069Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: R1069Q

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	5.1e-83	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	966	2.7e-93	PFAM
low complexity region	1004	1020	N/A	INTRINSIC
PDB:3LXU\|X	1021	1249	1e-20	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000189388

SMART Domains

Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	2.3e-81	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	880	7.8e-49	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190207
AA Change: R135Q

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140313
Gene: ENSMUSG00000041763
AA Change: R135Q

Domain	Start	End	E-Value	Type
low complexity region	70	86	N/A	INTRINSIC
PDB:3LXU\|X	87	281	3e-19	PDB

Meta Mutation Damage Score

0.0652

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	T	17: 48,163,414	I133N	probably benign	Het
Abca15	T	C	7: 120,360,919	S642P	probably damaging	Het
Abcg5	G	T	17: 84,660,141	Y410*	probably null	Het
Anapc7	T	A	5: 122,422,606	M10K	probably damaging	Het
Ank2	G	A	3: 127,032,096	T418M	probably benign	Het
Arhgap17	T	C	7: 123,308,360	R260G	possibly damaging	Het
Atp1a3	T	C	7: 24,994,626	T381A	probably damaging	Het
Cep89	T	G	7: 35,403,152	S97A	probably benign	Het
Cyp2j11	T	C	4: 96,316,382	D309G	probably damaging	Het
Dcbld2	T	C	16: 58,465,782	I768T	probably benign	Het
Dgke	A	G	11: 89,050,802	V249A	possibly damaging	Het
Dnah9	T	C	11: 66,084,611		probably null	Het
Dnajc3	C	A	14: 118,978,173	H502N	probably benign	Het
Dsp	A	G	13: 38,197,870	T2265A	probably damaging	Het
Enpp6	A	G	8: 47,065,461	D208G	probably benign	Het
Evc	C	T	5: 37,322,049		probably null	Het
Fam98a	A	G	17: 75,538,982	S285P	probably damaging	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm15293	C	T	8: 21,201,758	S52F	probably damaging	Het
Gsdmc	A	G	15: 63,804,380		probably null	Het
Gtpbp4	C	A	13: 8,985,217	D369Y	probably damaging	Het
H2-M1	A	G	17: 36,671,738	Y77H	probably benign	Het
Irx2	T	C	13: 72,632,610	V466A	possibly damaging	Het
Kcnh4	C	A	11: 100,752,253	W396L	probably damaging	Het
Kif27	T	C	13: 58,328,994	D614G	possibly damaging	Het
Kirrel2	C	A	7: 30,450,801		probably null	Het
Lcn5	A	G	2: 25,661,414	I182V	probably benign	Het
Ldb3	T	G	14: 34,566,858	S252R	probably damaging	Het
March8	G	A	6: 116,386,271		probably benign	Het
Mdn1	C	A	4: 32,756,512	Q4735K	probably benign	Het
Mfrp	A	T	9: 44,103,264	H236L	probably benign	Het
Mlph	A	G	1: 90,939,390	D378G	probably damaging	Het
Msi1	T	A	5: 115,450,885	Y320N	probably damaging	Het
Mtmr11	T	C	3: 96,163,250		probably benign	Het
Mtpap	T	C	18: 4,375,638	V6A	probably benign	Het
Nedd1	C	A	10: 92,695,031	D399Y	probably damaging	Het
Ninl	A	G	2: 150,939,909	Y234H	probably benign	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nle1	A	G	11: 82,904,937	V228A	probably benign	Het
Npy4r	T	A	14: 34,147,016	D105V	probably damaging	Het
Olfr1366	A	G	13: 21,537,982	Y8H	probably damaging	Het
Palld	C	T	8: 61,703,210	V464M	probably damaging	Het
Pclo	T	C	5: 14,669,221	V1124A	unknown	Het
Pex1	T	A	5: 3,609,924	M476K	probably benign	Het
Pkhd1l1	G	A	15: 44,504,025	S773N	probably benign	Het
Polrmt	A	G	10: 79,746,551	M1T	probably null	Het
Prmt9	A	G	8: 77,555,729	D85G	probably damaging	Het
Ptpn12	T	A	5: 21,015,708		probably null	Het
Rbm19	T	A	5: 120,141,566	M766K	probably damaging	Het
Rdh11	A	G	12: 79,188,606	V72A	probably benign	Het
Rxfp3	A	G	15: 11,036,281	V335A	probably damaging	Het
Sema6a	T	C	18: 47,298,251	K127E	possibly damaging	Het
Slc5a1	C	T	5: 33,160,782	T593I	probably benign	Het
Slco1a1	A	G	6: 141,923,099	F380L	probably benign	Het
Smc2	T	C	4: 52,450,826	S215P	probably damaging	Het
Smyd2	A	T	1: 189,882,188	V381E	probably damaging	Het
Smyd4	C	T	11: 75,382,294	S60L	probably benign	Het
Spata18	T	A	5: 73,678,993	V419E	probably damaging	Het
Terb1	A	G	8: 104,482,318	L376S	probably damaging	Het
Timd2	T	C	11: 46,682,790	E129G	possibly damaging	Het
Topbp1	C	A	9: 103,320,605	T461K	probably benign	Het
Ttn	A	G	2: 76,753,945	V22273A	probably damaging	Het
Tulp4	G	A	17: 6,198,813	E36K	probably damaging	Het
Uqcrfs1	A	T	13: 30,540,763	F265I	probably damaging	Het
Vmn2r107	A	T	17: 20,375,141	Q652L	probably damaging	Het
Vwf	C	T	6: 125,667,483	R2434*	probably null	Het
Wdhd1	A	G	14: 47,268,689	V256A	possibly damaging	Het
Zfp442	A	T	2: 150,408,495	C439S	probably damaging	Het
Zfp709	A	G	8: 71,889,788	T354A	probably benign	Het
Zswim2	A	T	2: 83,925,110	I149N	probably damaging	Het

Other mutations in Tpp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Tpp2	APN	1	43983291	missense	possibly damaging	0.90
IGL01021:Tpp2	APN	1	43934187	nonsense	probably null
IGL01096:Tpp2	APN	1	43960888	missense	probably damaging	1.00
IGL01344:Tpp2	APN	1	43983262	missense	probably benign	0.04
IGL01642:Tpp2	APN	1	43954653	missense	probably damaging	1.00
IGL02719:Tpp2	APN	1	43940231	missense	probably benign	0.09
IGL02890:Tpp2	APN	1	43999690	missense	probably damaging	1.00
IGL03102:Tpp2	APN	1	43956489	missense	probably damaging	1.00
IGL03175:Tpp2	APN	1	43973511	missense	probably benign	0.35
beaver	UTSW	1	43971715	missense	probably benign	0.08
billingsly	UTSW	1	43983552	missense	probably damaging	1.00
cleaver	UTSW	1	43978508	nonsense	probably null
dow	UTSW	1	43970392	splice site	probably benign
Eddie	UTSW	1	43968988	missense	probably damaging	1.00
jerry	UTSW	1	43978737	missense	probably benign	0.04
June	UTSW	1	43954710	missense	probably damaging	1.00
landers	UTSW	1	43977255	missense	probably damaging	1.00
mathers	UTSW	1	43992268	missense	probably damaging	1.00
recurrentis	UTSW	1	43992393	missense	probably null	0.29
state	UTSW	1	43978438	missense	possibly damaging	0.48
wally	UTSW	1	43992396	critical splice donor site	probably null
Ward	UTSW	1	43954736	missense	possibly damaging	0.82
wilson	UTSW	1	43972689	critical splice donor site	probably null
BB010:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
BB020:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R0001:Tpp2	UTSW	1	43971726	missense	probably benign	0.00
R0003:Tpp2	UTSW	1	43960139	missense	possibly damaging	0.94
R0066:Tpp2	UTSW	1	43981748	missense	possibly damaging	0.56
R0110:Tpp2	UTSW	1	43999693	missense	probably damaging	1.00
R0110:Tpp2	UTSW	1	43978504	missense	probably benign	0.00
R0167:Tpp2	UTSW	1	43970488	missense	probably benign	0.01
R0441:Tpp2	UTSW	1	43990562	missense	possibly damaging	0.85
R0520:Tpp2	UTSW	1	43990530	missense	probably damaging	1.00
R0639:Tpp2	UTSW	1	43975447	missense	probably benign	0.00
R1118:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1119:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1593:Tpp2	UTSW	1	43975433	missense	probably benign	0.01
R1702:Tpp2	UTSW	1	43990548	missense	probably damaging	0.99
R1756:Tpp2	UTSW	1	43978725	splice site	probably null
R2066:Tpp2	UTSW	1	43978438	missense	possibly damaging	0.48
R2171:Tpp2	UTSW	1	43957446	missense	probably benign	0.00
R2378:Tpp2	UTSW	1	43999765	missense	probably damaging	0.99
R2394:Tpp2	UTSW	1	43983186	missense	possibly damaging	0.83
R2507:Tpp2	UTSW	1	44001449	missense	probably benign	0.31
R2879:Tpp2	UTSW	1	43971623	missense	probably damaging	1.00
R3436:Tpp2	UTSW	1	43940144	missense	probably damaging	0.99
R4106:Tpp2	UTSW	1	44001457	missense	possibly damaging	0.71
R4658:Tpp2	UTSW	1	43954710	missense	probably damaging	1.00
R4760:Tpp2	UTSW	1	43971715	missense	probably benign	0.08
R5049:Tpp2	UTSW	1	44001473	missense	possibly damaging	0.46
R5073:Tpp2	UTSW	1	43954736	missense	possibly damaging	0.82
R6010:Tpp2	UTSW	1	43951213	critical splice donor site	probably null
R6118:Tpp2	UTSW	1	43940146	missense	probably damaging	1.00
R6155:Tpp2	UTSW	1	43956489	missense	probably damaging	1.00
R6169:Tpp2	UTSW	1	43983579	missense	probably damaging	0.99
R6236:Tpp2	UTSW	1	43977317	missense	probably benign	0.01
R6695:Tpp2	UTSW	1	43983276	missense	probably benign
R6845:Tpp2	UTSW	1	43978508	nonsense	probably null
R7054:Tpp2	UTSW	1	43983158	missense	probably damaging	1.00
R7094:Tpp2	UTSW	1	43968988	missense	probably damaging	1.00
R7223:Tpp2	UTSW	1	43968888	missense	probably damaging	1.00
R7316:Tpp2	UTSW	1	43970431	missense	probably benign	0.00
R7324:Tpp2	UTSW	1	43978778	missense	probably damaging	1.00
R7363:Tpp2	UTSW	1	43985422	missense	probably benign	0.00
R7454:Tpp2	UTSW	1	43954659	missense	probably benign	0.01
R7496:Tpp2	UTSW	1	43983517	missense	probably benign	0.09
R7699:Tpp2	UTSW	1	43970466	missense	probably benign
R7700:Tpp2	UTSW	1	43970466	missense	probably benign
R7804:Tpp2	UTSW	1	43983281	missense	probably benign	0.00
R7933:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R7979:Tpp2	UTSW	1	43940137	missense	probably benign	0.35
R8032:Tpp2	UTSW	1	43975468	missense	possibly damaging	0.82
R8101:Tpp2	UTSW	1	43970440	missense	probably damaging	1.00
R8245:Tpp2	UTSW	1	43983552	missense	probably damaging	1.00
R8314:Tpp2	UTSW	1	43934227	missense	probably benign	0.10
R8518:Tpp2	UTSW	1	43980385	missense	probably damaging	1.00
R8519:Tpp2	UTSW	1	43977205	critical splice acceptor site	probably null
R8529:Tpp2	UTSW	1	43983140	missense	probably benign
R8756:Tpp2	UTSW	1	43960135	nonsense	probably null
R8765:Tpp2	UTSW	1	43972689	critical splice donor site	probably null
R8773:Tpp2	UTSW	1	43970392	splice site	probably benign
R8915:Tpp2	UTSW	1	43977255	missense	probably damaging	1.00
R9049:Tpp2	UTSW	1	43953342	missense	possibly damaging	0.66
R9090:Tpp2	UTSW	1	43954651	missense	probably damaging	1.00
R9176:Tpp2	UTSW	1	43992393	missense	probably null	0.29
R9214:Tpp2	UTSW	1	43992354	missense	probably benign
R9271:Tpp2	UTSW	1	43954651	missense	probably damaging	1.00
R9316:Tpp2	UTSW	1	43978444	missense	probably damaging	0.97
R9371:Tpp2	UTSW	1	43960209	missense	probably damaging	1.00
R9422:Tpp2	UTSW	1	43978737	missense	probably benign	0.04
R9488:Tpp2	UTSW	1	44002112	missense	probably benign	0.03
R9513:Tpp2	UTSW	1	43978488	missense	probably benign	0.01
R9514:Tpp2	UTSW	1	43978488	missense	probably benign	0.01
R9516:Tpp2	UTSW	1	43978488	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAGGTCTCTCAAAAGCAGTTTG -3'
(R):5'- GGGACTTTTGGGATAGCATTAGAAATG -3'

Sequencing Primer
(F):5'- AAATGAGGATTTGGGGGAATTTTAC -3'
(R):5'- GGGTCAGTCTTCATTGCA -3'

Posted On

2016-04-27