Mutagenetix > Incidental Mutation

Incidental Mutation 'R4963:Ninl'

383697

Institutional Source

Beutler Lab

Gene Symbol

Ninl

Ensembl Gene

ENSMUSG00000068115

Gene Name

ninein-like

Synonyms

LOC381387, LOC381388, 4930519N13Rik

MMRRC Submission

042560-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150934519-151039382 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 150939909 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 234 (Y234H)

Ref Sequence

ENSEMBL: ENSMUSP00000122069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109896] [ENSMUST00000124135]

AlphaFold

Q6ZQ12

Predicted Effect

probably benign
Transcript: ENSMUST00000109896
AA Change: Y1219H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115
AA Change: Y1219H

Domain	Start	End	E-Value	Type
EFh	12	40	6.56e0	SMART
low complexity region	76	93	N/A	INTRINSIC
EFh	201	229	4.45e1	SMART
EFh	238	266	8.98e-4	SMART
low complexity region	295	306	N/A	INTRINSIC
coiled coil region	381	423	N/A	INTRINSIC
coiled coil region	461	517	N/A	INTRINSIC
coiled coil region	541	584	N/A	INTRINSIC
coiled coil region	620	699	N/A	INTRINSIC
coiled coil region	728	751	N/A	INTRINSIC
coiled coil region	835	863	N/A	INTRINSIC
coiled coil region	1058	1334	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124135
AA Change: Y234H

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000122069
Gene: ENSMUSG00000068115
AA Change: Y234H

Domain	Start	End	E-Value	Type
coiled coil region	16	61	N/A	INTRINSIC
coiled coil region	92	266	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150036

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone-marrow myeloid hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	T	17: 48,163,414	I133N	probably benign	Het
Abca15	T	C	7: 120,360,919	S642P	probably damaging	Het
Abcg5	G	T	17: 84,660,141	Y410*	probably null	Het
Anapc7	T	A	5: 122,422,606	M10K	probably damaging	Het
Ank2	G	A	3: 127,032,096	T418M	probably benign	Het
Arhgap17	T	C	7: 123,308,360	R260G	possibly damaging	Het
Atp1a3	T	C	7: 24,994,626	T381A	probably damaging	Het
Cep89	T	G	7: 35,403,152	S97A	probably benign	Het
Cyp2j11	T	C	4: 96,316,382	D309G	probably damaging	Het
Dcbld2	T	C	16: 58,465,782	I768T	probably benign	Het
Dgke	A	G	11: 89,050,802	V249A	possibly damaging	Het
Dnah9	T	C	11: 66,084,611		probably null	Het
Dnajc3	C	A	14: 118,978,173	H502N	probably benign	Het
Dsp	A	G	13: 38,197,870	T2265A	probably damaging	Het
Enpp6	A	G	8: 47,065,461	D208G	probably benign	Het
Evc	C	T	5: 37,322,049		probably null	Het
Fam98a	A	G	17: 75,538,982	S285P	probably damaging	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm15293	C	T	8: 21,201,758	S52F	probably damaging	Het
Gsdmc	A	G	15: 63,804,380		probably null	Het
Gtpbp4	C	A	13: 8,985,217	D369Y	probably damaging	Het
H2-M1	A	G	17: 36,671,738	Y77H	probably benign	Het
Irx2	T	C	13: 72,632,610	V466A	possibly damaging	Het
Kcnh4	C	A	11: 100,752,253	W396L	probably damaging	Het
Kif27	T	C	13: 58,328,994	D614G	possibly damaging	Het
Kirrel2	C	A	7: 30,450,801		probably null	Het
Lcn5	A	G	2: 25,661,414	I182V	probably benign	Het
Ldb3	T	G	14: 34,566,858	S252R	probably damaging	Het
March8	G	A	6: 116,386,271		probably benign	Het
Mdn1	C	A	4: 32,756,512	Q4735K	probably benign	Het
Mfrp	A	T	9: 44,103,264	H236L	probably benign	Het
Mlph	A	G	1: 90,939,390	D378G	probably damaging	Het
Msi1	T	A	5: 115,450,885	Y320N	probably damaging	Het
Mtmr11	T	C	3: 96,163,250		probably benign	Het
Mtpap	T	C	18: 4,375,638	V6A	probably benign	Het
Nedd1	C	A	10: 92,695,031	D399Y	probably damaging	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nle1	A	G	11: 82,904,937	V228A	probably benign	Het
Npy4r	T	A	14: 34,147,016	D105V	probably damaging	Het
Olfr1366	A	G	13: 21,537,982	Y8H	probably damaging	Het
Palld	C	T	8: 61,703,210	V464M	probably damaging	Het
Pclo	T	C	5: 14,669,221	V1124A	unknown	Het
Pex1	T	A	5: 3,609,924	M476K	probably benign	Het
Pkhd1l1	G	A	15: 44,504,025	S773N	probably benign	Het
Polrmt	A	G	10: 79,746,551	M1T	probably null	Het
Prmt9	A	G	8: 77,555,729	D85G	probably damaging	Het
Ptpn12	T	A	5: 21,015,708		probably null	Het
Rbm19	T	A	5: 120,141,566	M766K	probably damaging	Het
Rdh11	A	G	12: 79,188,606	V72A	probably benign	Het
Rxfp3	A	G	15: 11,036,281	V335A	probably damaging	Het
Sema6a	T	C	18: 47,298,251	K127E	possibly damaging	Het
Slc5a1	C	T	5: 33,160,782	T593I	probably benign	Het
Slco1a1	A	G	6: 141,923,099	F380L	probably benign	Het
Smc2	T	C	4: 52,450,826	S215P	probably damaging	Het
Smyd2	A	T	1: 189,882,188	V381E	probably damaging	Het
Smyd4	C	T	11: 75,382,294	S60L	probably benign	Het
Spata18	T	A	5: 73,678,993	V419E	probably damaging	Het
Terb1	A	G	8: 104,482,318	L376S	probably damaging	Het
Timd2	T	C	11: 46,682,790	E129G	possibly damaging	Het
Topbp1	C	A	9: 103,320,605	T461K	probably benign	Het
Tpp2	G	A	1: 43,992,268	R1069Q	probably damaging	Het
Ttn	A	G	2: 76,753,945	V22273A	probably damaging	Het
Tulp4	G	A	17: 6,198,813	E36K	probably damaging	Het
Uqcrfs1	A	T	13: 30,540,763	F265I	probably damaging	Het
Vmn2r107	A	T	17: 20,375,141	Q652L	probably damaging	Het
Vwf	C	T	6: 125,667,483	R2434*	probably null	Het
Wdhd1	A	G	14: 47,268,689	V256A	possibly damaging	Het
Zfp442	A	T	2: 150,408,495	C439S	probably damaging	Het
Zfp709	A	G	8: 71,889,788	T354A	probably benign	Het
Zswim2	A	T	2: 83,925,110	I149N	probably damaging	Het

Other mutations in Ninl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Ninl	APN	2	150966241	missense	probably damaging	0.98
IGL01697:Ninl	APN	2	150939947	missense	probably damaging	1.00
IGL01756:Ninl	APN	2	150979516	missense	probably damaging	1.00
IGL01925:Ninl	APN	2	150971059	missense	probably damaging	1.00
IGL02341:Ninl	APN	2	150944605	nonsense	probably null
IGL02838:Ninl	APN	2	150955711	splice site	probably null
IGL02868:Ninl	APN	2	150937054	missense	probably benign
IGL03116:Ninl	APN	2	150964219	missense	probably damaging	1.00
IGL03396:Ninl	APN	2	150966212	missense	possibly damaging	0.88
R0117:Ninl	UTSW	2	150937673	missense	probably damaging	0.98
R0685:Ninl	UTSW	2	150939855	missense	possibly damaging	0.73
R0928:Ninl	UTSW	2	150963475	missense	probably damaging	0.99
R1051:Ninl	UTSW	2	150970126	missense	probably damaging	1.00
R1441:Ninl	UTSW	2	150971124	missense	probably benign	0.10
R1493:Ninl	UTSW	2	150980095	missense	probably damaging	1.00
R1499:Ninl	UTSW	2	150980176	missense	possibly damaging	0.70
R1539:Ninl	UTSW	2	150975947	missense	probably damaging	1.00
R1658:Ninl	UTSW	2	150964159	missense	probably damaging	1.00
R2038:Ninl	UTSW	2	150975843	nonsense	probably null
R2156:Ninl	UTSW	2	150944583	missense	probably damaging	1.00
R2232:Ninl	UTSW	2	150950050	missense	probably benign	0.00
R2373:Ninl	UTSW	2	150980117	missense	probably damaging	1.00
R3743:Ninl	UTSW	2	150950248	missense	probably benign	0.01
R3906:Ninl	UTSW	2	150980119	missense	probably damaging	1.00
R3950:Ninl	UTSW	2	150952488	missense	possibly damaging	0.90
R4283:Ninl	UTSW	2	150953416	unclassified	probably benign
R4798:Ninl	UTSW	2	150959881	nonsense	probably null
R4998:Ninl	UTSW	2	150953364	missense	probably damaging	1.00
R5343:Ninl	UTSW	2	150971190	missense	probably benign	0.01
R5810:Ninl	UTSW	2	150950168	missense	probably benign	0.31
R5825:Ninl	UTSW	2	150940724	missense	probably damaging	1.00
R6436:Ninl	UTSW	2	150966178	missense	probably damaging	1.00
R6728:Ninl	UTSW	2	150975857	nonsense	probably null
R6734:Ninl	UTSW	2	150945083	critical splice donor site	probably null
R6997:Ninl	UTSW	2	150966225	missense	probably benign	0.08
R7135:Ninl	UTSW	2	150955604	missense	probably benign	0.00
R7157:Ninl	UTSW	2	150949343	missense	possibly damaging	0.63
R7315:Ninl	UTSW	2	150950050	missense	probably benign	0.00
R7840:Ninl	UTSW	2	150966096	missense	probably benign	0.00
R8134:Ninl	UTSW	2	150950314	missense	probably benign	0.01
R8319:Ninl	UTSW	2	150959907	missense	probably damaging	1.00
R8802:Ninl	UTSW	2	150935252	missense	probably damaging	1.00
R8997:Ninl	UTSW	2	150959896	missense	probably damaging	0.98
R9231:Ninl	UTSW	2	150950209	missense	probably benign
R9465:Ninl	UTSW	2	150940806	missense	possibly damaging	0.83
R9474:Ninl	UTSW	2	150940806	missense	probably benign	0.27
R9571:Ninl	UTSW	2	150949883	missense	probably benign
R9789:Ninl	UTSW	2	150949781	missense	probably benign	0.05
X0062:Ninl	UTSW	2	150970046	missense	probably damaging	1.00
Z1177:Ninl	UTSW	2	150953398	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGATGAGTTCCTGGTCAGC -3'
(R):5'- ATTAAGTGTGGTCCTTCGGC -3'

Sequencing Primer
(F):5'- TCCTGGTCAGCTGTGAAGC -3'
(R):5'- CTCGCAGGGTCATGGGAGATC -3'

Posted On

2016-04-27