Mutagenetix > Incidental Mutation

Incidental Mutation 'R4963:Pex1'

383704

Institutional Source

Beutler Lab

Gene Symbol

Pex1

Ensembl Gene

ENSMUSG00000005907

Gene Name

peroxisomal biogenesis factor 1

Synonyms

peroxisome biogenesis factor 1, ZWS1

MMRRC Submission

042560-MU

Accession Numbers

Genbank: NM_027777

Essential gene?

Possibly essential (E-score: 0.581) question?

Stock #

R4963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3596066-3637232 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3609924 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 476 (M476K)

Ref Sequence

ENSEMBL: ENSMUSP00000113304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000121291] [ENSMUST00000142516] [ENSMUST00000195894]

AlphaFold

Q5BL07

Predicted Effect

probably benign
Transcript: ENSMUST00000006061
AA Change: M436K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907
AA Change: M436K

Domain	Start	End	E-Value	Type
Pfam:PEX-2N	14	99	2.4e-53	PFAM
Pfam:PEX-1N	103	179	8.6e-27	PFAM
low complexity region	508	527	N/A	INTRINSIC
AAA	552	702	1.39e-10	SMART
low complexity region	754	765	N/A	INTRINSIC
AAA	834	970	4.07e-17	SMART
low complexity region	1024	1044	N/A	INTRINSIC
low complexity region	1051	1061	N/A	INTRINSIC
low complexity region	1065	1078	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121291
AA Change: M476K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907
AA Change: M476K

Domain	Start	End	E-Value	Type
Pfam:PEX-2N	17	98	8.7e-38	PFAM
Pfam:PEX-1N	104	179	1.4e-27	PFAM
low complexity region	548	567	N/A	INTRINSIC
AAA	592	742	1.39e-10	SMART
low complexity region	794	805	N/A	INTRINSIC
AAA	874	1010	4.07e-17	SMART
low complexity region	1064	1084	N/A	INTRINSIC
low complexity region	1091	1101	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123268

Predicted Effect

probably benign
Transcript: ENSMUST00000126545

SMART Domains

Protein: ENSMUSP00000121813
Gene: ENSMUSG00000005907

Domain	Start	End	E-Value	Type
low complexity region	88	107	N/A	INTRINSIC
Pfam:AAA	136	212	2.2e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142516

SMART Domains

Protein: ENSMUSP00000116474
Gene: ENSMUSG00000005907

Domain	Start	End	E-Value	Type
PDB:1WLF\|A	1	21	5e-8	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143959

Predicted Effect

probably benign
Transcript: ENSMUST00000195894

SMART Domains

Protein: ENSMUSP00000142620
Gene: ENSMUSG00000005907

Domain	Start	End	E-Value	Type
Pfam:PEX-2N	14	99	2.5e-51	PFAM

Meta Mutation Damage Score

0.0641

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA ATPase family, a large group of ATPases associated with diverse cellular activities. This protein is cytoplasmic but is often anchored to a peroxisomal membrane where it forms a heteromeric complex and plays a role in the import of proteins into peroxisomes and peroxisome biogenesis. Mutations in this gene have been associated with complementation group 1 peroxisomal disorders such as neonatal adrenoleukodystrophy, infantile Refsum disease, and Zellweger syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele display premature death, postnatal growth retardation, fatty livers, a bile acid defect associated with intestinal lipid malabsorption and cholestasis, and a retinopathy associated with retinal cone cell degenerationand abnormal cone and rod electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	T	17: 48,163,414	I133N	probably benign	Het
Abca15	T	C	7: 120,360,919	S642P	probably damaging	Het
Abcg5	G	T	17: 84,660,141	Y410*	probably null	Het
Anapc7	T	A	5: 122,422,606	M10K	probably damaging	Het
Ank2	G	A	3: 127,032,096	T418M	probably benign	Het
Arhgap17	T	C	7: 123,308,360	R260G	possibly damaging	Het
Atp1a3	T	C	7: 24,994,626	T381A	probably damaging	Het
Cep89	T	G	7: 35,403,152	S97A	probably benign	Het
Cyp2j11	T	C	4: 96,316,382	D309G	probably damaging	Het
Dcbld2	T	C	16: 58,465,782	I768T	probably benign	Het
Dgke	A	G	11: 89,050,802	V249A	possibly damaging	Het
Dnah9	T	C	11: 66,084,611		probably null	Het
Dnajc3	C	A	14: 118,978,173	H502N	probably benign	Het
Dsp	A	G	13: 38,197,870	T2265A	probably damaging	Het
Enpp6	A	G	8: 47,065,461	D208G	probably benign	Het
Evc	C	T	5: 37,322,049		probably null	Het
Fam98a	A	G	17: 75,538,982	S285P	probably damaging	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm15293	C	T	8: 21,201,758	S52F	probably damaging	Het
Gsdmc	A	G	15: 63,804,380		probably null	Het
Gtpbp4	C	A	13: 8,985,217	D369Y	probably damaging	Het
H2-M1	A	G	17: 36,671,738	Y77H	probably benign	Het
Irx2	T	C	13: 72,632,610	V466A	possibly damaging	Het
Kcnh4	C	A	11: 100,752,253	W396L	probably damaging	Het
Kif27	T	C	13: 58,328,994	D614G	possibly damaging	Het
Kirrel2	C	A	7: 30,450,801		probably null	Het
Lcn5	A	G	2: 25,661,414	I182V	probably benign	Het
Ldb3	T	G	14: 34,566,858	S252R	probably damaging	Het
March8	G	A	6: 116,386,271		probably benign	Het
Mdn1	C	A	4: 32,756,512	Q4735K	probably benign	Het
Mfrp	A	T	9: 44,103,264	H236L	probably benign	Het
Mlph	A	G	1: 90,939,390	D378G	probably damaging	Het
Msi1	T	A	5: 115,450,885	Y320N	probably damaging	Het
Mtmr11	T	C	3: 96,163,250		probably benign	Het
Mtpap	T	C	18: 4,375,638	V6A	probably benign	Het
Nedd1	C	A	10: 92,695,031	D399Y	probably damaging	Het
Ninl	A	G	2: 150,939,909	Y234H	probably benign	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nle1	A	G	11: 82,904,937	V228A	probably benign	Het
Npy4r	T	A	14: 34,147,016	D105V	probably damaging	Het
Olfr1366	A	G	13: 21,537,982	Y8H	probably damaging	Het
Palld	C	T	8: 61,703,210	V464M	probably damaging	Het
Pclo	T	C	5: 14,669,221	V1124A	unknown	Het
Pkhd1l1	G	A	15: 44,504,025	S773N	probably benign	Het
Polrmt	A	G	10: 79,746,551	M1T	probably null	Het
Prmt9	A	G	8: 77,555,729	D85G	probably damaging	Het
Ptpn12	T	A	5: 21,015,708		probably null	Het
Rbm19	T	A	5: 120,141,566	M766K	probably damaging	Het
Rdh11	A	G	12: 79,188,606	V72A	probably benign	Het
Rxfp3	A	G	15: 11,036,281	V335A	probably damaging	Het
Sema6a	T	C	18: 47,298,251	K127E	possibly damaging	Het
Slc5a1	C	T	5: 33,160,782	T593I	probably benign	Het
Slco1a1	A	G	6: 141,923,099	F380L	probably benign	Het
Smc2	T	C	4: 52,450,826	S215P	probably damaging	Het
Smyd2	A	T	1: 189,882,188	V381E	probably damaging	Het
Smyd4	C	T	11: 75,382,294	S60L	probably benign	Het
Spata18	T	A	5: 73,678,993	V419E	probably damaging	Het
Terb1	A	G	8: 104,482,318	L376S	probably damaging	Het
Timd2	T	C	11: 46,682,790	E129G	possibly damaging	Het
Topbp1	C	A	9: 103,320,605	T461K	probably benign	Het
Tpp2	G	A	1: 43,992,268	R1069Q	probably damaging	Het
Ttn	A	G	2: 76,753,945	V22273A	probably damaging	Het
Tulp4	G	A	17: 6,198,813	E36K	probably damaging	Het
Uqcrfs1	A	T	13: 30,540,763	F265I	probably damaging	Het
Vmn2r107	A	T	17: 20,375,141	Q652L	probably damaging	Het
Vwf	C	T	6: 125,667,483	R2434*	probably null	Het
Wdhd1	A	G	14: 47,268,689	V256A	possibly damaging	Het
Zfp442	A	T	2: 150,408,495	C439S	probably damaging	Het
Zfp709	A	G	8: 71,889,788	T354A	probably benign	Het
Zswim2	A	T	2: 83,925,110	I149N	probably damaging	Het

Other mutations in Pex1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01287:Pex1	APN	5	3606027	missense	probably benign	0.00
IGL01315:Pex1	APN	5	3609975	missense	probably damaging	1.00
IGL01671:Pex1	APN	5	3624088	missense	probably benign	0.00
IGL01863:Pex1	APN	5	3606066	missense	probably benign	0.01
IGL01933:Pex1	APN	5	3633789	missense	probably damaging	1.00
IGL01960:Pex1	APN	5	3627588	unclassified	probably benign
IGL02347:Pex1	APN	5	3603350	missense	probably damaging	0.98
IGL02374:Pex1	APN	5	3635481	missense	probably benign	0.01
IGL02392:Pex1	APN	5	3605952	nonsense	probably null
IGL02597:Pex1	APN	5	3635865	missense	possibly damaging	0.50
IGL02703:Pex1	APN	5	3615120	missense	probably benign	0.24
IGL02815:Pex1	APN	5	3636797	missense	probably damaging	0.97
IGL02862:Pex1	APN	5	3605424	intron	probably benign
IGL03005:Pex1	APN	5	3630292	missense	probably null	0.96
E0370:Pex1	UTSW	5	3631614	splice site	probably null
F5493:Pex1	UTSW	5	3635912	critical splice donor site	probably null
R0014:Pex1	UTSW	5	3626141	unclassified	probably benign
R0014:Pex1	UTSW	5	3626141	unclassified	probably benign
R0401:Pex1	UTSW	5	3633759	missense	probably damaging	1.00
R0480:Pex1	UTSW	5	3606444	splice site	probably null
R0555:Pex1	UTSW	5	3606130	missense	possibly damaging	0.89
R0976:Pex1	UTSW	5	3633943	missense	probably benign	0.00
R1200:Pex1	UTSW	5	3606411	critical splice donor site	probably null
R1672:Pex1	UTSW	5	3626085	missense	probably damaging	1.00
R1753:Pex1	UTSW	5	3630044	missense	probably damaging	1.00
R1880:Pex1	UTSW	5	3605770	missense	probably benign
R1953:Pex1	UTSW	5	3630038	missense	probably damaging	1.00
R2054:Pex1	UTSW	5	3603341	missense	possibly damaging	0.78
R2081:Pex1	UTSW	5	3624132	critical splice donor site	probably null
R2237:Pex1	UTSW	5	3618915	critical splice donor site	probably null
R3946:Pex1	UTSW	5	3626084	missense	probably damaging	1.00
R4528:Pex1	UTSW	5	3631712	missense	probably damaging	1.00
R4579:Pex1	UTSW	5	3618880	missense	probably benign	0.03
R4585:Pex1	UTSW	5	3633885	missense	probably damaging	1.00
R4586:Pex1	UTSW	5	3633885	missense	probably damaging	1.00
R4656:Pex1	UTSW	5	3604880	critical splice donor site	probably null
R4789:Pex1	UTSW	5	3630270	missense	probably damaging	0.98
R4850:Pex1	UTSW	5	3624426	missense	probably benign
R5005:Pex1	UTSW	5	3622310	missense	probably damaging	1.00
R5015:Pex1	UTSW	5	3620597	missense	probably damaging	1.00
R5019:Pex1	UTSW	5	3622331	missense	probably damaging	1.00
R5937:Pex1	UTSW	5	3624487	missense	possibly damaging	0.94
R5942:Pex1	UTSW	5	3610277	missense	probably benign	0.04
R5995:Pex1	UTSW	5	3607704	missense	possibly damaging	0.53
R6434:Pex1	UTSW	5	3630196	nonsense	probably null
R6552:Pex1	UTSW	5	3623953	missense	probably damaging	1.00
R6777:Pex1	UTSW	5	3622358	missense	probably benign	0.01
R6877:Pex1	UTSW	5	3635505	missense	probably benign	0.19
R6948:Pex1	UTSW	5	3605994	missense	probably benign	0.00
R7317:Pex1	UTSW	5	3618875	missense	probably damaging	1.00
R7408:Pex1	UTSW	5	3630222	missense	probably damaging	1.00
R7658:Pex1	UTSW	5	3596244	unclassified	probably benign
R8062:Pex1	UTSW	5	3605656	missense	probably benign
R8354:Pex1	UTSW	5	3631707	missense	probably damaging	1.00
R8366:Pex1	UTSW	5	3626007	missense	probably benign	0.00
R8482:Pex1	UTSW	5	3612923	missense	probably benign	0.00
R8673:Pex1	UTSW	5	3635886	missense	possibly damaging	0.65
R8812:Pex1	UTSW	5	3631614	missense	probably benign	0.00
R9004:Pex1	UTSW	5	3612914	missense	probably benign	0.01
R9031:Pex1	UTSW	5	3636844	missense	probably damaging	1.00
R9080:Pex1	UTSW	5	3605476	missense	probably damaging	1.00
R9586:Pex1	UTSW	5	3626047	missense	probably damaging	0.98
R9655:Pex1	UTSW	5	3605653	missense	probably damaging	1.00
R9758:Pex1	UTSW	5	3635876	missense	probably damaging	0.96
X0019:Pex1	UTSW	5	3605653	missense	probably damaging	1.00
X0027:Pex1	UTSW	5	3630270	missense	probably damaging	0.98
Z1088:Pex1	UTSW	5	3606075	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CATAGCAGGTCACGCATCAG -3'
(R):5'- AGAACACTGTTTCGTTTCACTG -3'

Sequencing Primer
(F):5'- GCATGTAGCGTCTGAACATCCTG -3'
(R):5'- GTTTCACTGTTCATGTGTGACAC -3'

Posted On

2016-04-27