Mutagenetix > Incidental Mutation

Incidental Mutation 'R4963:Slc5a1'

383707

Institutional Source

Beutler Lab

Gene Symbol

Slc5a1

Ensembl Gene

ENSMUSG00000011034

Gene Name

solute carrier family 5 (sodium/glucose cotransporter), member 1

Synonyms

Sglt1, sodium glucose cotransporter 1

MMRRC Submission

042560-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R4963 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33104219-33162870 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33160782 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 593 (T593I)

Ref Sequence

ENSEMBL: ENSMUSP00000011178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011178]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000011178
AA Change: T593I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000011178
Gene: ENSMUSG00000011034
AA Change: T593I

Domain	Start	End	E-Value	Type
transmembrane domain	26	48	N/A	INTRINSIC
Pfam:SSF	58	492	2.6e-174	PFAM
transmembrane domain	526	548	N/A	INTRINSIC
low complexity region	620	634	N/A	INTRINSIC
transmembrane domain	641	663	N/A	INTRINSIC

Meta Mutation Damage Score

0.0631

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-dependent glucose transporter (SGLT) family. The encoded integral membrane protein is the primary mediator of dietary glucose and galactose uptake from the intestinal lumen. Mutations in this gene have been associated with glucose-galactose malabsorption. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality unless maintained on a glucose-galatose-free diet, distended intestine, impaired glucose transport across the brush border membrane and impaired renal glucose reabsorption. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	T	17: 48,163,414	I133N	probably benign	Het
Abca15	T	C	7: 120,360,919	S642P	probably damaging	Het
Abcg5	G	T	17: 84,660,141	Y410*	probably null	Het
Anapc7	T	A	5: 122,422,606	M10K	probably damaging	Het
Ank2	G	A	3: 127,032,096	T418M	probably benign	Het
Arhgap17	T	C	7: 123,308,360	R260G	possibly damaging	Het
Atp1a3	T	C	7: 24,994,626	T381A	probably damaging	Het
Cep89	T	G	7: 35,403,152	S97A	probably benign	Het
Cyp2j11	T	C	4: 96,316,382	D309G	probably damaging	Het
Dcbld2	T	C	16: 58,465,782	I768T	probably benign	Het
Dgke	A	G	11: 89,050,802	V249A	possibly damaging	Het
Dnah9	T	C	11: 66,084,611		probably null	Het
Dnajc3	C	A	14: 118,978,173	H502N	probably benign	Het
Dsp	A	G	13: 38,197,870	T2265A	probably damaging	Het
Enpp6	A	G	8: 47,065,461	D208G	probably benign	Het
Evc	C	T	5: 37,322,049		probably null	Het
Fam98a	A	G	17: 75,538,982	S285P	probably damaging	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm15293	C	T	8: 21,201,758	S52F	probably damaging	Het
Gsdmc	A	G	15: 63,804,380		probably null	Het
Gtpbp4	C	A	13: 8,985,217	D369Y	probably damaging	Het
H2-M1	A	G	17: 36,671,738	Y77H	probably benign	Het
Irx2	T	C	13: 72,632,610	V466A	possibly damaging	Het
Kcnh4	C	A	11: 100,752,253	W396L	probably damaging	Het
Kif27	T	C	13: 58,328,994	D614G	possibly damaging	Het
Kirrel2	C	A	7: 30,450,801		probably null	Het
Lcn5	A	G	2: 25,661,414	I182V	probably benign	Het
Ldb3	T	G	14: 34,566,858	S252R	probably damaging	Het
March8	G	A	6: 116,386,271		probably benign	Het
Mdn1	C	A	4: 32,756,512	Q4735K	probably benign	Het
Mfrp	A	T	9: 44,103,264	H236L	probably benign	Het
Mlph	A	G	1: 90,939,390	D378G	probably damaging	Het
Msi1	T	A	5: 115,450,885	Y320N	probably damaging	Het
Mtmr11	T	C	3: 96,163,250		probably benign	Het
Mtpap	T	C	18: 4,375,638	V6A	probably benign	Het
Nedd1	C	A	10: 92,695,031	D399Y	probably damaging	Het
Ninl	A	G	2: 150,939,909	Y234H	probably benign	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nle1	A	G	11: 82,904,937	V228A	probably benign	Het
Npy4r	T	A	14: 34,147,016	D105V	probably damaging	Het
Olfr1366	A	G	13: 21,537,982	Y8H	probably damaging	Het
Palld	C	T	8: 61,703,210	V464M	probably damaging	Het
Pclo	T	C	5: 14,669,221	V1124A	unknown	Het
Pex1	T	A	5: 3,609,924	M476K	probably benign	Het
Pkhd1l1	G	A	15: 44,504,025	S773N	probably benign	Het
Polrmt	A	G	10: 79,746,551	M1T	probably null	Het
Prmt9	A	G	8: 77,555,729	D85G	probably damaging	Het
Ptpn12	T	A	5: 21,015,708		probably null	Het
Rbm19	T	A	5: 120,141,566	M766K	probably damaging	Het
Rdh11	A	G	12: 79,188,606	V72A	probably benign	Het
Rxfp3	A	G	15: 11,036,281	V335A	probably damaging	Het
Sema6a	T	C	18: 47,298,251	K127E	possibly damaging	Het
Slco1a1	A	G	6: 141,923,099	F380L	probably benign	Het
Smc2	T	C	4: 52,450,826	S215P	probably damaging	Het
Smyd2	A	T	1: 189,882,188	V381E	probably damaging	Het
Smyd4	C	T	11: 75,382,294	S60L	probably benign	Het
Spata18	T	A	5: 73,678,993	V419E	probably damaging	Het
Terb1	A	G	8: 104,482,318	L376S	probably damaging	Het
Timd2	T	C	11: 46,682,790	E129G	possibly damaging	Het
Topbp1	C	A	9: 103,320,605	T461K	probably benign	Het
Tpp2	G	A	1: 43,992,268	R1069Q	probably damaging	Het
Ttn	A	G	2: 76,753,945	V22273A	probably damaging	Het
Tulp4	G	A	17: 6,198,813	E36K	probably damaging	Het
Uqcrfs1	A	T	13: 30,540,763	F265I	probably damaging	Het
Vmn2r107	A	T	17: 20,375,141	Q652L	probably damaging	Het
Vwf	C	T	6: 125,667,483	R2434*	probably null	Het
Wdhd1	A	G	14: 47,268,689	V256A	possibly damaging	Het
Zfp442	A	T	2: 150,408,495	C439S	probably damaging	Het
Zfp709	A	G	8: 71,889,788	T354A	probably benign	Het
Zswim2	A	T	2: 83,925,110	I149N	probably damaging	Het

Other mutations in Slc5a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01573:Slc5a1	APN	5	33160865	missense	probably benign
IGL01872:Slc5a1	APN	5	33154637	missense	probably damaging	0.97
IGL01906:Slc5a1	APN	5	33154653	missense	probably damaging	1.00
IGL02614:Slc5a1	APN	5	33154601	missense	probably benign	0.02
IGL03241:Slc5a1	APN	5	33133405	missense	probably benign	0.00
IGL03336:Slc5a1	APN	5	33146943	missense	probably benign	0.24
R0314:Slc5a1	UTSW	5	33146651	missense	probably benign	0.02
R0421:Slc5a1	UTSW	5	33134652	missense	probably damaging	1.00
R0755:Slc5a1	UTSW	5	33133389	missense	probably benign	0.14
R0791:Slc5a1	UTSW	5	33158077	splice site	probably benign
R1506:Slc5a1	UTSW	5	33154708	missense	possibly damaging	0.72
R1801:Slc5a1	UTSW	5	33146953	missense	probably damaging	1.00
R2143:Slc5a1	UTSW	5	33160796	missense	probably benign
R2190:Slc5a1	UTSW	5	33104593	critical splice donor site	probably null
R3796:Slc5a1	UTSW	5	33152652	missense	probably damaging	1.00
R4423:Slc5a1	UTSW	5	33154674	missense	possibly damaging	0.49
R4465:Slc5a1	UTSW	5	33146516	missense	possibly damaging	0.89
R4588:Slc5a1	UTSW	5	33145288	missense	probably benign	0.01
R4722:Slc5a1	UTSW	5	33146711	missense	possibly damaging	0.86
R4826:Slc5a1	UTSW	5	33159150	missense	probably benign
R4934:Slc5a1	UTSW	5	33104514	missense	probably benign
R4955:Slc5a1	UTSW	5	33160902	missense	probably benign	0.02
R5008:Slc5a1	UTSW	5	33152573	missense	possibly damaging	0.75
R5094:Slc5a1	UTSW	5	33158280	missense	probably damaging	1.00
R5292:Slc5a1	UTSW	5	33158241	missense	probably benign
R5654:Slc5a1	UTSW	5	33146611	missense	probably benign	0.00
R6784:Slc5a1	UTSW	5	33158116	missense	probably benign	0.00
R7585:Slc5a1	UTSW	5	33160944	missense	probably damaging	1.00
R7734:Slc5a1	UTSW	5	33160935	missense	probably benign
R7751:Slc5a1	UTSW	5	33133417	missense	possibly damaging	0.63
R7827:Slc5a1	UTSW	5	33146713	missense	probably damaging	1.00
R8755:Slc5a1	UTSW	5	33159182	missense	probably benign	0.01
R9433:Slc5a1	UTSW	5	33152681	missense	probably benign	0.00
RF020:Slc5a1	UTSW	5	33133429	missense	probably damaging	1.00
X0064:Slc5a1	UTSW	5	33134636	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCGAGGATGCAGAATTCAGTTC -3'
(R):5'- CATGGCAGAAGACAGCTACC -3'

Sequencing Primer
(F):5'- CTGCACTGCCTGGCACATAAATC -3'
(R):5'- CCAGCAGGATAATACCGTTGATGTTC -3'

Posted On

2016-04-27