Incidental Mutation 'R4963:March8'
ID383713
Institutional Source Beutler Lab
Gene Symbol March8
Ensembl Gene ENSMUSG00000025702
Gene Namemembrane-associated ring finger (C3HC4) 8
Synonyms1300017E09Rik, Mir
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116338024-116409540 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 116386271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079012] [ENSMUST00000101032] [ENSMUST00000123405] [ENSMUST00000135901] [ENSMUST00000140884] [ENSMUST00000203116] [ENSMUST00000203193] [ENSMUST00000204657]
Predicted Effect probably benign
Transcript: ENSMUST00000079012
SMART Domains Protein: ENSMUSP00000078024
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101032
SMART Domains Protein: ENSMUSP00000098594
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123246
Predicted Effect probably benign
Transcript: ENSMUST00000123405
SMART Domains Protein: ENSMUSP00000144936
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
RINGv 357 405 2.4e-25 SMART
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130445
Predicted Effect probably benign
Transcript: ENSMUST00000135901
SMART Domains Protein: ENSMUSP00000115510
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 43 60 N/A INTRINSIC
RINGv 71 119 1.16e-23 SMART
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140884
SMART Domains Protein: ENSMUSP00000145060
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203116
Predicted Effect probably benign
Transcript: ENSMUST00000203193
SMART Domains Protein: ENSMUSP00000145137
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
RINGv 36 84 2.9e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204657
SMART Domains Protein: ENSMUSP00000145351
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 2.9e-26 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205183
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the membrane-associated really interesting new gene-CH family of proteins. These proteins are E3 ubiquitin-protein ligases that modulate antigen presentation by downregulating major histocompatibility complex class II surface expression through endocytosis. The transcript is primarily expressed by dendritic cells and macrophages. Overexpression of this gene in antigen presenting cells results in immune defective phenotypes, including resistance to autoimmune disease onset. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal CD4+ T cell compartment in the thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in March8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:March8 APN 6 116403538 missense probably damaging 1.00
strider UTSW 6 116402043 missense probably benign
R0828:March8 UTSW 6 116405678 missense probably benign 0.36
R2869:March8 UTSW 6 116401145 intron probably benign
R2870:March8 UTSW 6 116401145 intron probably benign
R5617:March8 UTSW 6 116403520 missense possibly damaging 0.55
R6329:March8 UTSW 6 116406316 missense possibly damaging 0.78
R6361:March8 UTSW 6 116402101 missense probably null 1.00
R6615:March8 UTSW 6 116405663 missense probably damaging 1.00
R6771:March8 UTSW 6 116402043 missense probably benign
R7014:March8 UTSW 6 116403543 missense probably damaging 1.00
R7014:March8 UTSW 6 116403544 missense probably damaging 1.00
R7249:March8 UTSW 6 116406234 missense probably benign 0.17
R7558:March8 UTSW 6 116403565 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCAGCTGGAGGAAGTAGTTAGTCC -3'
(R):5'- CAATGCTAATATGGCCTGCAAG -3'

Sequencing Primer
(F):5'- GGAATGTTGCACTCAAGTCC -3'
(R):5'- ATGGCCTGCAAGATTACTGC -3'
Posted On2016-04-27