Incidental Mutation 'R4963:Atp1a3'
ID383716
Institutional Source Beutler Lab
Gene Symbol Atp1a3
Ensembl Gene ENSMUSG00000040907
Gene NameATPase, Na+/K+ transporting, alpha 3 polypeptide
SynonymsAtpa-2
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24978167-25005958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24994626 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 381 (T381A)
Ref Sequence ENSEMBL: ENSMUSP00000143735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080882] [ENSMUST00000102858] [ENSMUST00000196684]
AlphaFold Q6PIC6
Predicted Effect probably damaging
Transcript: ENSMUST00000080882
AA Change: T368A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079691
Gene: ENSMUSG00000040907
AA Change: T368A

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 125 356 6.3e-64 PFAM
Pfam:Hydrolase 360 719 2.6e-32 PFAM
Pfam:HAD 363 716 4.7e-18 PFAM
Pfam:Hydrolase_like2 416 511 5.7e-26 PFAM
Pfam:Cation_ATPase_C 789 998 3.5e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102858
AA Change: T368A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099922
Gene: ENSMUSG00000040907
AA Change: T368A

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 124 355 4.6e-60 PFAM
Pfam:Hydrolase 360 719 5.7e-20 PFAM
Pfam:HAD 363 716 4.5e-19 PFAM
Pfam:Cation_ATPase 416 511 5.1e-25 PFAM
Pfam:Cation_ATPase_C 789 998 1.4e-46 PFAM
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146595
Predicted Effect probably damaging
Transcript: ENSMUST00000196684
AA Change: T381A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143735
Gene: ENSMUSG00000040907
AA Change: T381A

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Cation_ATPase_N 45 119 1.9e-26 SMART
Pfam:E1-E2_ATPase 137 368 4e-58 PFAM
Pfam:Hydrolase 373 732 3.8e-18 PFAM
Pfam:HAD 376 729 3.8e-17 PFAM
Pfam:Cation_ATPase 429 524 5.2e-23 PFAM
Pfam:Cation_ATPase_C 802 1011 2.5e-44 PFAM
Meta Mutation Damage Score 0.9682 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 3 subunit. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display neonatal lethality. Heterozygous mice display hyperactivity, increased activity in responses to methamphetamine, and impaired spatial learning. Mice heterozygous for an ENU mutation exhibit convulsive and vestibular stress induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Atp1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Atp1a3 APN 7 24997286 missense probably damaging 0.98
IGL02736:Atp1a3 APN 7 24980109 missense probably damaging 1.00
IGL02738:Atp1a3 APN 7 24990476 missense possibly damaging 0.86
IGL02806:Atp1a3 APN 7 24981872 missense probably damaging 1.00
borah UTSW 7 24994569 missense probably damaging 1.00
Clonic UTSW 7 24987985 missense probably benign 0.37
Littlewolf UTSW 7 24981791 missense probably damaging 1.00
R0003:Atp1a3 UTSW 7 24989564 splice site probably benign
R0254:Atp1a3 UTSW 7 24981512 splice site probably benign
R0420:Atp1a3 UTSW 7 24980627 missense probably benign
R0437:Atp1a3 UTSW 7 24998967 missense probably benign 0.36
R0666:Atp1a3 UTSW 7 24990549 missense probably benign 0.01
R0932:Atp1a3 UTSW 7 24987976 critical splice donor site probably null
R1586:Atp1a3 UTSW 7 24979383 missense probably damaging 0.97
R1981:Atp1a3 UTSW 7 25000975 missense probably benign 0.19
R2105:Atp1a3 UTSW 7 24989853 missense probably damaging 1.00
R3076:Atp1a3 UTSW 7 24980073 missense possibly damaging 0.48
R3110:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R3112:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R4223:Atp1a3 UTSW 7 25000930 missense probably benign 0.09
R4327:Atp1a3 UTSW 7 24987631 intron probably benign
R4598:Atp1a3 UTSW 7 24979341 missense probably damaging 0.99
R4626:Atp1a3 UTSW 7 24998768 missense possibly damaging 0.75
R4789:Atp1a3 UTSW 7 24998964 missense probably damaging 1.00
R5243:Atp1a3 UTSW 7 24994569 missense probably damaging 1.00
R5294:Atp1a3 UTSW 7 24988048 missense probably damaging 0.98
R5668:Atp1a3 UTSW 7 24978869 intron probably benign
R5704:Atp1a3 UTSW 7 24997311 missense probably damaging 0.98
R5870:Atp1a3 UTSW 7 24997578 missense probably benign 0.03
R5934:Atp1a3 UTSW 7 24978874 intron probably benign
R6183:Atp1a3 UTSW 7 24981752 missense probably damaging 1.00
R6492:Atp1a3 UTSW 7 24979304 missense probably damaging 1.00
R6996:Atp1a3 UTSW 7 24997626 missense probably damaging 1.00
R7165:Atp1a3 UTSW 7 24978965 missense probably benign 0.13
R7229:Atp1a3 UTSW 7 24987985 missense probably benign 0.37
R7239:Atp1a3 UTSW 7 25000704 missense probably damaging 1.00
R7301:Atp1a3 UTSW 7 24990515 missense probably benign 0.00
R7330:Atp1a3 UTSW 7 25001152 nonsense probably null
R7348:Atp1a3 UTSW 7 24978826 missense unknown
R7432:Atp1a3 UTSW 7 25005875 unclassified probably benign
R7490:Atp1a3 UTSW 7 24987470 missense probably damaging 1.00
R7556:Atp1a3 UTSW 7 24981566 missense probably benign 0.02
R7860:Atp1a3 UTSW 7 24981791 missense probably damaging 1.00
R7861:Atp1a3 UTSW 7 25001148 missense unknown
R7993:Atp1a3 UTSW 7 25000981 critical splice acceptor site probably null
R8002:Atp1a3 UTSW 7 25000671 missense probably damaging 1.00
R8010:Atp1a3 UTSW 7 24980645 missense possibly damaging 0.90
R8430:Atp1a3 UTSW 7 24999012 missense probably damaging 1.00
R8780:Atp1a3 UTSW 7 24981554 missense probably damaging 0.96
R8837:Atp1a3 UTSW 7 24978555 missense probably damaging 1.00
R9031:Atp1a3 UTSW 7 24989787 critical splice donor site probably null
Z1176:Atp1a3 UTSW 7 24998688 missense probably benign 0.00
Z1177:Atp1a3 UTSW 7 24980119 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTGTCGAAAGAGGTCCCTG -3'
(R):5'- TGAACAGTCATTCCACAGCC -3'

Sequencing Primer
(F):5'- AGAGGTCCCTGTGAGGAGTC -3'
(R):5'- TCAGGTGATATGAGCTGAGCCC -3'
Posted On2016-04-27