Incidental Mutation 'R4963:Kirrel2'
ID383717
Institutional Source Beutler Lab
Gene Symbol Kirrel2
Ensembl Gene ENSMUSG00000036915
Gene Namekirre like nephrin family adhesion molecule 2
SynonymsC330019F22Rik, NEPH3
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30447534-30457690 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 30450801 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000045817]
Predicted Effect probably null
Transcript: ENSMUST00000045817
SMART Domains Protein: ENSMUSP00000039395
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG 128 219 5.13e-1 SMART
IG_like 230 306 8.06e0 SMART
IGc2 321 379 3.06e-8 SMART
IG_like 401 500 4.65e1 SMART
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 547 565 N/A INTRINSIC
low complexity region 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140565
Predicted Effect probably benign
Transcript: ENSMUST00000169893
SMART Domains Protein: ENSMUSP00000131161
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG_like 118 189 5.91e-1 SMART
IG_like 211 287 8.06e0 SMART
IGc2 302 360 3.06e-8 SMART
IG_like 382 481 4.65e1 SMART
transmembrane domain 490 512 N/A INTRINSIC
low complexity region 528 546 N/A INTRINSIC
low complexity region 588 610 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170152
SMART Domains Protein: ENSMUSP00000132652
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170152
SMART Domains Protein: ENSMUSP00000132652
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
Meta Mutation Damage Score 0.6032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein and member of the immunoglobulin superfamily of cell adhesion molecules. The encoded protein localizes to adherens junctions in pancreatic beta cells and regulates insulin secretion. Autoantibodies against the encoded protein have been detected in serum from patients with type 1 diabetes. This gene may also play a role in glomerular development and decreased expression of this gene has been observed in human glomerular diseases. This gene and the related opposite-strand gene nephrin (GeneID: 527362) are regulated by a bidirectional promoter. [provided by RefSeq, Jul 2016]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Kirrel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Kirrel2 APN 7 30453664 missense probably benign 0.03
IGL02457:Kirrel2 APN 7 30452740 missense probably damaging 1.00
IGL02609:Kirrel2 APN 7 30448340 missense probably benign 0.00
R0029:Kirrel2 UTSW 7 30453165 unclassified probably benign
R0395:Kirrel2 UTSW 7 30450458 missense possibly damaging 0.68
R0987:Kirrel2 UTSW 7 30448130 missense probably damaging 1.00
R1511:Kirrel2 UTSW 7 30456498 missense probably damaging 1.00
R2226:Kirrel2 UTSW 7 30454154 missense probably damaging 1.00
R4818:Kirrel2 UTSW 7 30449868 missense probably benign 0.32
R6918:Kirrel2 UTSW 7 30450814 missense probably damaging 1.00
R6985:Kirrel2 UTSW 7 30455306 missense probably damaging 1.00
R6995:Kirrel2 UTSW 7 30455179 missense probably damaging 1.00
R7014:Kirrel2 UTSW 7 30454574 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACCCTGAGGAAACTGAGCAG -3'
(R):5'- TTGCTGCCCACTGTACACAC -3'

Sequencing Primer
(F):5'- CAGGACTAGGGATAAGATGAGCCC -3'
(R):5'- GCTAGCTGCCCACACTGTATAC -3'
Posted On2016-04-27