Incidental Mutation 'R4963:Arhgap17'
ID383720
Institutional Source Beutler Lab
Gene Symbol Arhgap17
Ensembl Gene ENSMUSG00000030766
Gene NameRho GTPase activating protein 17
SynonymsNadrin2, Nadrin, WBP15, 5730403H17Rik, Rich1
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location123279218-123369915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123308360 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 260 (R260G)
Ref Sequence ENSEMBL: ENSMUSP00000145628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098060] [ENSMUST00000106442] [ENSMUST00000167309] [ENSMUST00000205262] [ENSMUST00000206117] [ENSMUST00000207010]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098060
AA Change: R260G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095668
Gene: ENSMUSG00000030766
AA Change: R260G

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 554 595 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 644 664 N/A INTRINSIC
low complexity region 683 704 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106442
AA Change: R260G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102050
Gene: ENSMUSG00000030766
AA Change: R260G

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167309
AA Change: R260G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128447
Gene: ENSMUSG00000030766
AA Change: R260G

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205262
AA Change: R260G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206294
Predicted Effect possibly damaging
Transcript: ENSMUST00000207010
AA Change: R260G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1885 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICH1 is a GTPase-activating protein (GAP). GAPs stimulate the intrinsic GTP hydrolysis of small G proteins, such as RHOA (MIM 165390), RAC1 (MIM 602048), and CDC42 (MIM 116952).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Arhgap17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Arhgap17 APN 7 123286568 utr 3 prime probably benign
IGL02112:Arhgap17 APN 7 123318417 missense possibly damaging 0.92
IGL02117:Arhgap17 APN 7 123286773 utr 3 prime probably benign
IGL03062:Arhgap17 APN 7 123321874 splice site probably null
gensing UTSW 7 123314690 missense probably damaging 1.00
Nightshade UTSW 7 123327244 missense probably damaging 1.00
tuberose UTSW 7 123308377 missense probably damaging 1.00
P0028:Arhgap17 UTSW 7 123286677 utr 3 prime probably benign
R0480:Arhgap17 UTSW 7 123294644 missense probably damaging 0.98
R0593:Arhgap17 UTSW 7 123286743 utr 3 prime probably benign
R0594:Arhgap17 UTSW 7 123294518 missense probably benign 0.00
R0599:Arhgap17 UTSW 7 123303790 splice site probably benign
R0751:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1184:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1791:Arhgap17 UTSW 7 123286702 missense probably benign 0.23
R2036:Arhgap17 UTSW 7 123318494 missense possibly damaging 0.92
R3428:Arhgap17 UTSW 7 123323631 missense probably damaging 1.00
R4032:Arhgap17 UTSW 7 123280066 utr 3 prime probably benign
R4119:Arhgap17 UTSW 7 123306994 missense probably damaging 1.00
R4652:Arhgap17 UTSW 7 123286618 utr 3 prime probably benign
R4687:Arhgap17 UTSW 7 123321603 missense probably damaging 1.00
R4910:Arhgap17 UTSW 7 123308377 missense probably damaging 1.00
R4960:Arhgap17 UTSW 7 123286926 utr 3 prime probably benign
R5028:Arhgap17 UTSW 7 123294673 missense probably benign 0.05
R5253:Arhgap17 UTSW 7 123303748 missense probably benign 0.00
R5316:Arhgap17 UTSW 7 123296527 missense possibly damaging 0.63
R5410:Arhgap17 UTSW 7 123297493 critical splice donor site probably null
R5890:Arhgap17 UTSW 7 123286758 utr 3 prime probably benign
R6367:Arhgap17 UTSW 7 123308363 makesense probably null
R6376:Arhgap17 UTSW 7 123300504 missense probably damaging 1.00
R6513:Arhgap17 UTSW 7 123292156 missense possibly damaging 0.87
R6862:Arhgap17 UTSW 7 123321901 missense probably damaging 0.98
R6962:Arhgap17 UTSW 7 123296432 missense probably damaging 1.00
R7077:Arhgap17 UTSW 7 123280008 missense unknown
R7178:Arhgap17 UTSW 7 123285358 intron probably null
R7205:Arhgap17 UTSW 7 123306438 missense probably damaging 1.00
R7342:Arhgap17 UTSW 7 123327244 missense probably damaging 1.00
R7524:Arhgap17 UTSW 7 123306420 missense probably damaging 1.00
R7812:Arhgap17 UTSW 7 123280067 missense unknown
RF009:Arhgap17 UTSW 7 123286862 small deletion probably benign
RF015:Arhgap17 UTSW 7 123286862 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGGTTTGAAAGCCACTGG -3'
(R):5'- CAAAAGCTCACCAGATGTCTG -3'

Sequencing Primer
(F):5'- GGTTTGAAAGCCACTGGTCTATACC -3'
(R):5'- CAGATGTCTGGGTGTTTCTCTTCTC -3'
Posted On2016-04-27