Incidental Mutation 'R4963:Prmt9'
ID383725
Institutional Source Beutler Lab
Gene Symbol Prmt9
Ensembl Gene ENSMUSG00000037134
Gene Nameprotein arginine methyltransferase 9
SynonymsPrmt10
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location77549397-77581338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77555729 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 85 (D85G)
Ref Sequence ENSEMBL: ENSMUSP00000050181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056237] [ENSMUST00000118622] [ENSMUST00000210040]
Predicted Effect probably damaging
Transcript: ENSMUST00000056237
AA Change: D85G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050181
Gene: ENSMUSG00000037134
AA Change: D85G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_11 67 132 1.2e-7 PFAM
Pfam:TPR_2 102 134 7.9e-5 PFAM
Pfam:PrmA 168 257 2.5e-10 PFAM
internal_repeat_1 585 836 1.37e-10 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000118622
AA Change: D85G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112692
Gene: ENSMUSG00000037134
AA Change: D85G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_2 102 134 3e-5 PFAM
Pfam:PrmA 168 257 4.9e-10 PFAM
internal_repeat_1 585 836 1.05e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142824
Predicted Effect probably damaging
Transcript: ENSMUST00000210040
AA Change: D85G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.7261 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Prmt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Prmt9 APN 8 77562440 missense probably damaging 1.00
IGL02306:Prmt9 APN 8 77560818 missense probably benign 0.06
IGL02971:Prmt9 APN 8 77565069 missense probably benign 0.00
1mM(1):Prmt9 UTSW 8 77555764 missense probably benign 0.01
R0004:Prmt9 UTSW 8 77555782 missense possibly damaging 0.81
R0928:Prmt9 UTSW 8 77581176 missense probably damaging 1.00
R1328:Prmt9 UTSW 8 77572654 missense possibly damaging 0.86
R1777:Prmt9 UTSW 8 77565108 missense probably benign 0.05
R1826:Prmt9 UTSW 8 77555674 nonsense probably null
R1925:Prmt9 UTSW 8 77577339 missense possibly damaging 0.52
R3855:Prmt9 UTSW 8 77568265 missense probably benign 0.22
R3856:Prmt9 UTSW 8 77568265 missense probably benign 0.22
R4089:Prmt9 UTSW 8 77572545 missense probably benign 0.00
R5196:Prmt9 UTSW 8 77564997 missense probably benign 0.30
R5413:Prmt9 UTSW 8 77572009 missense possibly damaging 0.95
R5975:Prmt9 UTSW 8 77561018 intron probably benign
R6271:Prmt9 UTSW 8 77577463 missense probably damaging 0.96
R7023:Prmt9 UTSW 8 77549457 start gained probably benign
R7107:Prmt9 UTSW 8 77568251 missense possibly damaging 0.62
R7159:Prmt9 UTSW 8 77555764 missense probably benign 0.01
R7209:Prmt9 UTSW 8 77564998 missense probably benign 0.32
X0027:Prmt9 UTSW 8 77560883 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GAGGCCATCATTCATTTCAGGC -3'
(R):5'- CAAGATGTAAGCCTACAAGTTCCAG -3'

Sequencing Primer
(F):5'- AGGCTCAGTTCCACTTGCTGG -3'
(R):5'- TGTAAGCCTACAAGTTCCAGACTGG -3'
Posted On2016-04-27