Incidental Mutation 'R4963:Nedd1'
ID 383731
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Name neural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission 042560-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R4963 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 92520608-92558282 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 92530893 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 399 (D399Y)
Ref Sequence ENSEMBL: ENSMUSP00000020163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163]
AlphaFold P33215
Predicted Effect probably damaging
Transcript: ENSMUST00000020163
AA Change: D399Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: D399Y

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214417
Meta Mutation Damage Score 0.1191 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,470,582 (GRCm39) I133N probably benign Het
Abca15 T C 7: 119,960,142 (GRCm39) S642P probably damaging Het
Abcg5 G T 17: 84,967,569 (GRCm39) Y410* probably null Het
Anapc7 T A 5: 122,560,669 (GRCm39) M10K probably damaging Het
Ank2 G A 3: 126,825,745 (GRCm39) T418M probably benign Het
Arhgap17 T C 7: 122,907,583 (GRCm39) R260G possibly damaging Het
Atp1a3 T C 7: 24,694,051 (GRCm39) T381A probably damaging Het
Cep89 T G 7: 35,102,577 (GRCm39) S97A probably benign Het
Cyp2j11 T C 4: 96,204,619 (GRCm39) D309G probably damaging Het
Dcbld2 T C 16: 58,286,145 (GRCm39) I768T probably benign Het
Defa41 C T 8: 21,691,774 (GRCm39) S52F probably damaging Het
Dgke A G 11: 88,941,628 (GRCm39) V249A possibly damaging Het
Dnah9 T C 11: 65,975,437 (GRCm39) probably null Het
Dnajc3 C A 14: 119,215,585 (GRCm39) H502N probably benign Het
Dsp A G 13: 38,381,846 (GRCm39) T2265A probably damaging Het
Enpp6 A G 8: 47,518,496 (GRCm39) D208G probably benign Het
Evc C T 5: 37,479,393 (GRCm39) probably null Het
Fam98a A G 17: 75,845,977 (GRCm39) S285P probably damaging Het
Glp2r G T 11: 67,648,419 (GRCm39) Y94* probably null Het
Gsdmc A G 15: 63,676,229 (GRCm39) probably null Het
Gtpbp4 C A 13: 9,035,253 (GRCm39) D369Y probably damaging Het
H2-M1 A G 17: 36,982,630 (GRCm39) Y77H probably benign Het
Irx2 T C 13: 72,780,729 (GRCm39) V466A possibly damaging Het
Kcnh4 C A 11: 100,643,079 (GRCm39) W396L probably damaging Het
Kif27 T C 13: 58,476,808 (GRCm39) D614G possibly damaging Het
Kirrel2 C A 7: 30,150,226 (GRCm39) probably null Het
Lcn5 A G 2: 25,551,426 (GRCm39) I182V probably benign Het
Ldb3 T G 14: 34,288,815 (GRCm39) S252R probably damaging Het
Marchf8 G A 6: 116,363,232 (GRCm39) probably benign Het
Mdn1 C A 4: 32,756,512 (GRCm39) Q4735K probably benign Het
Mfrp A T 9: 44,014,561 (GRCm39) H236L probably benign Het
Mlph A G 1: 90,867,112 (GRCm39) D378G probably damaging Het
Msi1 T A 5: 115,588,944 (GRCm39) Y320N probably damaging Het
Mtmr11 T C 3: 96,070,567 (GRCm39) probably benign Het
Mtpap T C 18: 4,375,638 (GRCm39) V6A probably benign Het
Ninl A G 2: 150,781,829 (GRCm39) Y234H probably benign Het
Nkx3-1 G A 14: 69,428,367 (GRCm39) G72S probably benign Het
Nle1 A G 11: 82,795,763 (GRCm39) V228A probably benign Het
Npy4r T A 14: 33,868,973 (GRCm39) D105V probably damaging Het
Or1f12 A G 13: 21,722,152 (GRCm39) Y8H probably damaging Het
Palld C T 8: 62,156,244 (GRCm39) V464M probably damaging Het
Pclo T C 5: 14,719,235 (GRCm39) V1124A unknown Het
Pex1 T A 5: 3,659,924 (GRCm39) M476K probably benign Het
Pkhd1l1 G A 15: 44,367,421 (GRCm39) S773N probably benign Het
Polrmt A G 10: 79,582,385 (GRCm39) M1T probably null Het
Prmt9 A G 8: 78,282,358 (GRCm39) D85G probably damaging Het
Ptpn12 T A 5: 21,220,706 (GRCm39) probably null Het
Rbm19 T A 5: 120,279,631 (GRCm39) M766K probably damaging Het
Rdh11 A G 12: 79,235,380 (GRCm39) V72A probably benign Het
Rxfp3 A G 15: 11,036,367 (GRCm39) V335A probably damaging Het
Sema6a T C 18: 47,431,318 (GRCm39) K127E possibly damaging Het
Slc5a1 C T 5: 33,318,126 (GRCm39) T593I probably benign Het
Slco1a1 A G 6: 141,868,825 (GRCm39) F380L probably benign Het
Smc2 T C 4: 52,450,826 (GRCm39) S215P probably damaging Het
Smyd2 A T 1: 189,614,385 (GRCm39) V381E probably damaging Het
Smyd4 C T 11: 75,273,120 (GRCm39) S60L probably benign Het
Spata18 T A 5: 73,836,336 (GRCm39) V419E probably damaging Het
Terb1 A G 8: 105,208,950 (GRCm39) L376S probably damaging Het
Timd2 T C 11: 46,573,617 (GRCm39) E129G possibly damaging Het
Topbp1 C A 9: 103,197,804 (GRCm39) T461K probably benign Het
Tpp2 G A 1: 44,031,428 (GRCm39) R1069Q probably damaging Het
Ttn A G 2: 76,584,289 (GRCm39) V22273A probably damaging Het
Tulp4 G A 17: 6,249,088 (GRCm39) E36K probably damaging Het
Uqcrfs1 A T 13: 30,724,746 (GRCm39) F265I probably damaging Het
Vmn2r107 A T 17: 20,595,403 (GRCm39) Q652L probably damaging Het
Vwf C T 6: 125,644,446 (GRCm39) R2434* probably null Het
Wdhd1 A G 14: 47,506,146 (GRCm39) V256A possibly damaging Het
Zfp442 A T 2: 150,250,415 (GRCm39) C439S probably damaging Het
Zfp709 A G 8: 72,643,632 (GRCm39) T354A probably benign Het
Zswim2 A T 2: 83,755,454 (GRCm39) I149N probably damaging Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92,530,836 (GRCm39) splice site probably benign
IGL00988:Nedd1 APN 10 92,525,548 (GRCm39) missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92,534,031 (GRCm39) critical splice donor site probably null
IGL01588:Nedd1 APN 10 92,522,124 (GRCm39) missense probably benign 0.12
IGL01988:Nedd1 APN 10 92,550,021 (GRCm39) missense probably benign 0.39
IGL02706:Nedd1 APN 10 92,522,147 (GRCm39) missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92,525,519 (GRCm39) nonsense probably null
IGL03011:Nedd1 APN 10 92,525,503 (GRCm39) missense possibly damaging 0.92
Brainless UTSW 10 92,526,635 (GRCm39) missense probably benign 0.01
R0125:Nedd1 UTSW 10 92,527,791 (GRCm39) missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92,534,745 (GRCm39) missense probably benign 0.30
R0244:Nedd1 UTSW 10 92,552,127 (GRCm39) intron probably benign
R0645:Nedd1 UTSW 10 92,527,693 (GRCm39) splice site probably null
R0791:Nedd1 UTSW 10 92,555,476 (GRCm39) missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92,536,660 (GRCm39) missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92,555,476 (GRCm39) missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92,534,601 (GRCm39) missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92,550,022 (GRCm39) missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92,555,465 (GRCm39) missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92,549,988 (GRCm39) missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92,530,860 (GRCm39) missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92,555,444 (GRCm39) missense probably benign 0.00
R4798:Nedd1 UTSW 10 92,534,772 (GRCm39) missense probably benign 0.00
R4830:Nedd1 UTSW 10 92,522,120 (GRCm39) missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92,547,074 (GRCm39) missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92,522,102 (GRCm39) missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92,552,054 (GRCm39) missense probably benign 0.04
R5534:Nedd1 UTSW 10 92,530,894 (GRCm39) missense probably benign 0.01
R6045:Nedd1 UTSW 10 92,530,962 (GRCm39) nonsense probably null
R6154:Nedd1 UTSW 10 92,534,104 (GRCm39) missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92,527,737 (GRCm39) missense probably benign
R6692:Nedd1 UTSW 10 92,534,199 (GRCm39) missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92,534,199 (GRCm39) missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92,547,168 (GRCm39) missense probably damaging 1.00
R7011:Nedd1 UTSW 10 92,526,635 (GRCm39) missense probably benign 0.01
R7406:Nedd1 UTSW 10 92,547,185 (GRCm39) splice site probably null
R7455:Nedd1 UTSW 10 92,536,787 (GRCm39) missense probably benign 0.01
R7587:Nedd1 UTSW 10 92,534,592 (GRCm39) missense probably benign 0.01
R7745:Nedd1 UTSW 10 92,550,034 (GRCm39) missense probably benign
R8104:Nedd1 UTSW 10 92,527,778 (GRCm39) missense probably damaging 1.00
R8209:Nedd1 UTSW 10 92,527,797 (GRCm39) missense probably benign
R8226:Nedd1 UTSW 10 92,527,797 (GRCm39) missense probably benign
R8925:Nedd1 UTSW 10 92,558,258 (GRCm39) start gained probably benign
R8927:Nedd1 UTSW 10 92,558,258 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGGGGATTGGAACCATGTAC -3'
(R):5'- TAAACTTGCACCAGGGTGGG -3'

Sequencing Primer
(F):5'- CCATGTACAGTGACTAGCATTTGC -3'
(R):5'- ACCAGGGTGGGTAATGTCCATTTTAC -3'
Posted On 2016-04-27