Incidental Mutation 'R4963:Olfr1366'
ID383740
Institutional Source Beutler Lab
Gene Symbol Olfr1366
Ensembl Gene ENSMUSG00000048996
Gene Nameolfactory receptor 1366
SynonymsMOR130-2, GA_x6K02T2QHY8-11707053-11707994
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21535113-21542808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21537982 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 8 (Y8H)
Ref Sequence ENSEMBL: ENSMUSP00000151506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168629] [ENSMUST00000175637] [ENSMUST00000205976] [ENSMUST00000218154]
Predicted Effect probably benign
Transcript: ENSMUST00000168629
SMART Domains Protein: ENSMUSP00000132776
Gene: ENSMUSG00000048996

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:7tm_4 46 323 1.1e-59 PFAM
Pfam:7TM_GPCR_Srsx 50 320 4e-7 PFAM
Pfam:7tm_1 56 305 1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175637
SMART Domains Protein: ENSMUSP00000135446
Gene: ENSMUSG00000048996

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 231 3e-7 PFAM
Pfam:7tm_1 41 237 8.7e-33 PFAM
Pfam:7tm_4 139 240 2.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205976
Predicted Effect probably damaging
Transcript: ENSMUST00000218154
AA Change: Y8H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Olfr1366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Olfr1366 APN 13 21537942 missense possibly damaging 0.50
IGL02827:Olfr1366 APN 13 21537358 missense probably benign 0.43
R0528:Olfr1366 UTSW 13 21537246 missense possibly damaging 0.95
R1650:Olfr1366 UTSW 13 21537079 missense probably damaging 1.00
R2168:Olfr1366 UTSW 13 21537252 missense probably damaging 1.00
R4936:Olfr1366 UTSW 13 21537187 missense probably benign 0.00
X0028:Olfr1366 UTSW 13 21537774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATTGTTTGAACCAATGGC -3'
(R):5'- CTGATGATGTTGAGCCTAAAGC -3'

Sequencing Primer
(F):5'- GTTTGAACCAATGGCTAACAAGATG -3'
(R):5'- GTCATAAAGACAACAGATGGGAC -3'
Posted On2016-04-27