Incidental Mutation 'R4963:Or1f12'
ID 383740
Institutional Source Beutler Lab
Gene Symbol Or1f12
Ensembl Gene ENSMUSG00000048996
Gene Name olfactory receptor family 1 subfamily F member 12
Synonyms MOR130-2, GA_x6K02T2QHY8-11707053-11707994, Olfr1366
MMRRC Submission 042560-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R4963 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 21721144-21722197 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21722152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 8 (Y8H)
Ref Sequence ENSEMBL: ENSMUSP00000151506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168629] [ENSMUST00000175637] [ENSMUST00000205976] [ENSMUST00000218154]
AlphaFold A0A1W2P740
Predicted Effect probably benign
Transcript: ENSMUST00000168629
SMART Domains Protein: ENSMUSP00000132776
Gene: ENSMUSG00000048996

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:7tm_4 46 323 1.1e-59 PFAM
Pfam:7TM_GPCR_Srsx 50 320 4e-7 PFAM
Pfam:7tm_1 56 305 1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175637
SMART Domains Protein: ENSMUSP00000135446
Gene: ENSMUSG00000048996

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 231 3e-7 PFAM
Pfam:7tm_1 41 237 8.7e-33 PFAM
Pfam:7tm_4 139 240 2.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205976
Predicted Effect probably damaging
Transcript: ENSMUST00000218154
AA Change: Y8H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,470,582 (GRCm39) I133N probably benign Het
Abca15 T C 7: 119,960,142 (GRCm39) S642P probably damaging Het
Abcg5 G T 17: 84,967,569 (GRCm39) Y410* probably null Het
Anapc7 T A 5: 122,560,669 (GRCm39) M10K probably damaging Het
Ank2 G A 3: 126,825,745 (GRCm39) T418M probably benign Het
Arhgap17 T C 7: 122,907,583 (GRCm39) R260G possibly damaging Het
Atp1a3 T C 7: 24,694,051 (GRCm39) T381A probably damaging Het
Cep89 T G 7: 35,102,577 (GRCm39) S97A probably benign Het
Cyp2j11 T C 4: 96,204,619 (GRCm39) D309G probably damaging Het
Dcbld2 T C 16: 58,286,145 (GRCm39) I768T probably benign Het
Defa41 C T 8: 21,691,774 (GRCm39) S52F probably damaging Het
Dgke A G 11: 88,941,628 (GRCm39) V249A possibly damaging Het
Dnah9 T C 11: 65,975,437 (GRCm39) probably null Het
Dnajc3 C A 14: 119,215,585 (GRCm39) H502N probably benign Het
Dsp A G 13: 38,381,846 (GRCm39) T2265A probably damaging Het
Enpp6 A G 8: 47,518,496 (GRCm39) D208G probably benign Het
Evc C T 5: 37,479,393 (GRCm39) probably null Het
Fam98a A G 17: 75,845,977 (GRCm39) S285P probably damaging Het
Glp2r G T 11: 67,648,419 (GRCm39) Y94* probably null Het
Gsdmc A G 15: 63,676,229 (GRCm39) probably null Het
Gtpbp4 C A 13: 9,035,253 (GRCm39) D369Y probably damaging Het
H2-M1 A G 17: 36,982,630 (GRCm39) Y77H probably benign Het
Irx2 T C 13: 72,780,729 (GRCm39) V466A possibly damaging Het
Kcnh4 C A 11: 100,643,079 (GRCm39) W396L probably damaging Het
Kif27 T C 13: 58,476,808 (GRCm39) D614G possibly damaging Het
Kirrel2 C A 7: 30,150,226 (GRCm39) probably null Het
Lcn5 A G 2: 25,551,426 (GRCm39) I182V probably benign Het
Ldb3 T G 14: 34,288,815 (GRCm39) S252R probably damaging Het
Marchf8 G A 6: 116,363,232 (GRCm39) probably benign Het
Mdn1 C A 4: 32,756,512 (GRCm39) Q4735K probably benign Het
Mfrp A T 9: 44,014,561 (GRCm39) H236L probably benign Het
Mlph A G 1: 90,867,112 (GRCm39) D378G probably damaging Het
Msi1 T A 5: 115,588,944 (GRCm39) Y320N probably damaging Het
Mtmr11 T C 3: 96,070,567 (GRCm39) probably benign Het
Mtpap T C 18: 4,375,638 (GRCm39) V6A probably benign Het
Nedd1 C A 10: 92,530,893 (GRCm39) D399Y probably damaging Het
Ninl A G 2: 150,781,829 (GRCm39) Y234H probably benign Het
Nkx3-1 G A 14: 69,428,367 (GRCm39) G72S probably benign Het
Nle1 A G 11: 82,795,763 (GRCm39) V228A probably benign Het
Npy4r T A 14: 33,868,973 (GRCm39) D105V probably damaging Het
Palld C T 8: 62,156,244 (GRCm39) V464M probably damaging Het
Pclo T C 5: 14,719,235 (GRCm39) V1124A unknown Het
Pex1 T A 5: 3,659,924 (GRCm39) M476K probably benign Het
Pkhd1l1 G A 15: 44,367,421 (GRCm39) S773N probably benign Het
Polrmt A G 10: 79,582,385 (GRCm39) M1T probably null Het
Prmt9 A G 8: 78,282,358 (GRCm39) D85G probably damaging Het
Ptpn12 T A 5: 21,220,706 (GRCm39) probably null Het
Rbm19 T A 5: 120,279,631 (GRCm39) M766K probably damaging Het
Rdh11 A G 12: 79,235,380 (GRCm39) V72A probably benign Het
Rxfp3 A G 15: 11,036,367 (GRCm39) V335A probably damaging Het
Sema6a T C 18: 47,431,318 (GRCm39) K127E possibly damaging Het
Slc5a1 C T 5: 33,318,126 (GRCm39) T593I probably benign Het
Slco1a1 A G 6: 141,868,825 (GRCm39) F380L probably benign Het
Smc2 T C 4: 52,450,826 (GRCm39) S215P probably damaging Het
Smyd2 A T 1: 189,614,385 (GRCm39) V381E probably damaging Het
Smyd4 C T 11: 75,273,120 (GRCm39) S60L probably benign Het
Spata18 T A 5: 73,836,336 (GRCm39) V419E probably damaging Het
Terb1 A G 8: 105,208,950 (GRCm39) L376S probably damaging Het
Timd2 T C 11: 46,573,617 (GRCm39) E129G possibly damaging Het
Topbp1 C A 9: 103,197,804 (GRCm39) T461K probably benign Het
Tpp2 G A 1: 44,031,428 (GRCm39) R1069Q probably damaging Het
Ttn A G 2: 76,584,289 (GRCm39) V22273A probably damaging Het
Tulp4 G A 17: 6,249,088 (GRCm39) E36K probably damaging Het
Uqcrfs1 A T 13: 30,724,746 (GRCm39) F265I probably damaging Het
Vmn2r107 A T 17: 20,595,403 (GRCm39) Q652L probably damaging Het
Vwf C T 6: 125,644,446 (GRCm39) R2434* probably null Het
Wdhd1 A G 14: 47,506,146 (GRCm39) V256A possibly damaging Het
Zfp442 A T 2: 150,250,415 (GRCm39) C439S probably damaging Het
Zfp709 A G 8: 72,643,632 (GRCm39) T354A probably benign Het
Zswim2 A T 2: 83,755,454 (GRCm39) I149N probably damaging Het
Other mutations in Or1f12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Or1f12 APN 13 21,722,112 (GRCm39) missense possibly damaging 0.50
IGL02827:Or1f12 APN 13 21,721,528 (GRCm39) missense probably benign 0.43
R0528:Or1f12 UTSW 13 21,721,416 (GRCm39) missense possibly damaging 0.95
R1650:Or1f12 UTSW 13 21,721,249 (GRCm39) missense probably damaging 1.00
R2168:Or1f12 UTSW 13 21,721,422 (GRCm39) missense probably damaging 1.00
R4936:Or1f12 UTSW 13 21,721,357 (GRCm39) missense probably benign 0.00
R8117:Or1f12 UTSW 13 21,722,122 (GRCm39) missense probably benign
R9272:Or1f12 UTSW 13 21,721,864 (GRCm39) missense possibly damaging 0.69
X0028:Or1f12 UTSW 13 21,721,944 (GRCm39) missense probably damaging 1.00
Z1177:Or1f12 UTSW 13 21,721,419 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTGATTGTTTGAACCAATGGC -3'
(R):5'- CTGATGATGTTGAGCCTAAAGC -3'

Sequencing Primer
(F):5'- GTTTGAACCAATGGCTAACAAGATG -3'
(R):5'- GTCATAAAGACAACAGATGGGAC -3'
Posted On 2016-04-27