Incidental Mutation 'R4964:Ddx18'
ID383763
Institutional Source Beutler Lab
Gene Symbol Ddx18
Ensembl Gene ENSMUSG00000001674
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms
MMRRC Submission 042561-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R4964 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location121553835-121567989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121566094 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 54 (K54E)
Ref Sequence ENSEMBL: ENSMUSP00000001724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001724]
Predicted Effect probably benign
Transcript: ENSMUST00000001724
AA Change: K54E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000001724
Gene: ENSMUSG00000001674
AA Change: K54E

DomainStartEndE-ValueType
coiled coil region 2 32 N/A INTRINSIC
internal_repeat_1 36 75 1.67e-5 PROSPERO
internal_repeat_1 66 105 1.67e-5 PROSPERO
low complexity region 109 117 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
DEXDc 188 393 1.95e-56 SMART
low complexity region 401 417 N/A INTRINSIC
HELICc 429 510 2.84e-26 SMART
DUF4217 550 613 1.65e-26 SMART
low complexity region 620 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131471
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 98% (100/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 probably benign Het
9030619P08Rik T A 15: 75,431,418 noncoding transcript Het
9030624J02Rik T C 7: 118,780,268 I426T possibly damaging Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abcb1b A T 5: 8,812,671 T118S probably benign Het
Abcb1b T A 5: 8,861,602 I133N probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Ankmy2 A G 12: 36,186,918 K242E possibly damaging Het
Apc2 A C 10: 80,314,007 I1603L probably benign Het
Arhgef25 T A 10: 127,185,603 I249F probably damaging Het
Birc3 T C 9: 7,860,552 H255R probably benign Het
Cables1 A T 18: 11,941,277 R486W possibly damaging Het
Caskin1 A T 17: 24,507,161 D1414V probably damaging Het
Ccdc175 A G 12: 72,180,845 S55P probably damaging Het
Ccdc57 A T 11: 120,861,152 S868T probably benign Het
Ccny A T 18: 9,449,516 probably null Het
Cdc34b A T 11: 94,742,261 I96F probably damaging Het
Ctnnd1 A G 2: 84,622,073 F69L possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Cyb5rl A G 4: 107,069,132 probably benign Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dlg1 C T 16: 31,754,808 T9I probably benign Het
Dnase1 T C 16: 4,037,907 probably benign Het
Drd4 T C 7: 141,293,777 M114T probably damaging Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Eif2s1 T A 12: 78,880,011 N178K probably benign Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Galntl6 T C 8: 58,699,911 probably benign Het
Glipr1l2 T A 10: 112,106,999 I253K possibly damaging Het
Gnat1 A T 9: 107,677,234 M115K probably benign Het
Gtsf2 T C 15: 103,444,328 E88G possibly damaging Het
Hormad1 T A 3: 95,585,220 probably null Het
Hydin A T 8: 110,490,673 I1398F possibly damaging Het
Ifnar1 T C 16: 91,505,086 V483A probably benign Het
Ints11 T C 4: 155,886,928 F278L probably damaging Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Krt7 C T 15: 101,413,972 R104C probably damaging Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mef2d T A 3: 88,168,097 I422N probably damaging Het
Mipep G T 14: 60,784,782 R32L probably damaging Het
Mon1a A G 9: 107,902,651 E473G probably damaging Het
Mterf2 T A 10: 85,120,115 Q215L probably damaging Het
Mybpc1 T A 10: 88,555,663 Y324F probably benign Het
Myh11 T C 16: 14,205,954 E1512G probably damaging Het
Myo1g A T 11: 6,515,976 F370I probably damaging Het
Myo5c T A 9: 75,297,509 M1548K possibly damaging Het
Myof T A 19: 37,935,852 I1306F probably damaging Het
Nle1 A G 11: 82,908,192 F21S probably damaging Het
Noc2l C G 4: 156,245,911 D513E probably damaging Het
Olfr23 A T 11: 73,941,202 I319F probably benign Het
Olfr30 A G 11: 58,455,907 V14A probably benign Het
Orc1 T C 4: 108,614,473 *841R probably null Het
Patz1 A G 11: 3,307,720 D573G probably damaging Het
Pcdhga3 A G 18: 37,676,101 T536A probably benign Het
Pde6h C T 6: 136,961,203 T58I possibly damaging Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pkd1 T C 17: 24,586,068 probably null Het
Polr1e G A 4: 45,029,429 A297T probably damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Ryr2 T C 13: 11,714,611 E2375G possibly damaging Het
Ryr2 T C 13: 11,833,992 T361A probably benign Het
Serpina3m T C 12: 104,389,101 I9T probably benign Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Sf3b1 T C 1: 54,999,712 N804S probably benign Het
Shroom1 A G 11: 53,465,172 T350A probably benign Het
Slc24a5 G A 2: 125,068,268 V30I probably benign Het
Slc38a8 A T 8: 119,482,684 probably null Het
Smarcd1 A G 15: 99,707,981 S378G possibly damaging Het
Stx1b T C 7: 127,807,921 I55V probably damaging Het
Sult2a8 A G 7: 14,425,532 V54A probably damaging Het
Tacc2 T C 7: 130,728,777 S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 I114T probably benign Het
Tmco6 T C 18: 36,735,502 probably null Het
Treh T C 9: 44,682,648 L144P probably damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Ttbk2 A T 2: 120,773,277 F258L possibly damaging Het
Ttn T C 2: 76,955,036 D665G probably damaging Het
Unc93b1 T C 19: 3,942,023 probably null Het
Uroc1 T C 6: 90,345,394 L300P probably damaging Het
Xbp1 A G 11: 5,521,125 E44G probably damaging Het
Zfp451 A T 1: 33,777,861 V119D probably damaging Het
Zfp457 T A 13: 67,293,278 H315L probably damaging Het
Zfp518a T A 19: 40,915,851 V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 L171R probably benign Het
Zfp712 C T 13: 67,040,612 C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 N67S probably benign Het
Other mutations in Ddx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ddx18 APN 1 121564586 missense probably benign 0.00
IGL01999:Ddx18 APN 1 121561728 missense probably benign 0.19
IGL03056:Ddx18 APN 1 121564535 missense probably benign 0.00
IGL03388:Ddx18 APN 1 121565923 missense possibly damaging 0.86
R0550:Ddx18 UTSW 1 121555375 missense probably benign 0.40
R1883:Ddx18 UTSW 1 121567916 start gained probably benign
R1940:Ddx18 UTSW 1 121555224 missense probably damaging 1.00
R2169:Ddx18 UTSW 1 121558409 critical splice donor site probably null
R3113:Ddx18 UTSW 1 121566148 missense possibly damaging 0.65
R3414:Ddx18 UTSW 1 121562149 missense probably benign
R3763:Ddx18 UTSW 1 121561377 missense probably damaging 0.99
R4011:Ddx18 UTSW 1 121562081 missense probably benign 0.01
R4293:Ddx18 UTSW 1 121561392 missense probably benign 0.10
R4333:Ddx18 UTSW 1 121564602 missense probably benign 0.01
R5160:Ddx18 UTSW 1 121565879 critical splice donor site probably null
R5187:Ddx18 UTSW 1 121562128 missense probably damaging 0.98
R5259:Ddx18 UTSW 1 121567789 critical splice donor site probably null
R5656:Ddx18 UTSW 1 121561358 missense probably damaging 1.00
R7949:Ddx18 UTSW 1 121555318 missense probably damaging 1.00
R8291:Ddx18 UTSW 1 121560175 missense probably damaging 0.99
R8318:Ddx18 UTSW 1 121566087 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAGCTGAAAAGCTATCTGAATGACC -3'
(R):5'- TGATTGGGGTTCCAGAAAACC -3'

Sequencing Primer
(F):5'- AGGCCCGGCATCATTTG -3'
(R):5'- CCATAATTTCTCCTGTGAAGGTCAG -3'
Posted On2016-04-27