Incidental Mutation 'R4964:Ints11'
ID383777
Institutional Source Beutler Lab
Gene Symbol Ints11
Ensembl Gene ENSMUSG00000029034
Gene Nameintegrator complex subunit 11
Synonyms2410006F12Rik, Cpsf3l
MMRRC Submission 042561-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4964 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155869546-155889103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155886928 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 278 (F278L)
Ref Sequence ENSEMBL: ENSMUSP00000112656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030901] [ENSMUST00000079031] [ENSMUST00000097737] [ENSMUST00000105584] [ENSMUST00000120794] [ENSMUST00000156460]
Predicted Effect probably damaging
Transcript: ENSMUST00000030901
AA Change: F300L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030901
Gene: ENSMUSG00000029034
AA Change: F300L

DomainStartEndE-ValueType
Lactamase_B 16 233 3.38e-17 SMART
Beta-Casp 245 363 6.94e-37 SMART
Pfam:RMMBL 376 418 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079031
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097737
SMART Domains Protein: ENSMUSP00000095344
Gene: ENSMUSG00000051557

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 16 124 2.5e-12 PFAM
Pfam:PseudoU_synth_1 168 285 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105584
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120794
AA Change: F278L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112656
Gene: ENSMUSG00000029034
AA Change: F278L

DomainStartEndE-ValueType
Lactamase_B 16 211 6.42e-9 SMART
Beta-Casp 223 341 6.94e-37 SMART
Pfam:RMMBL 354 396 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142724
Predicted Effect probably benign
Transcript: ENSMUST00000156460
SMART Domains Protein: ENSMUSP00000118803
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
SCOP:d1smla_ 1 66 7e-7 SMART
PDB:2I7V|A 3 38 1e-9 PDB
Blast:Lactamase_B 16 66 4e-30 BLAST
Meta Mutation Damage Score 0.8717 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 98% (100/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex contains at least 12 subunits and associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates the 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690). INTS11, or CPSF3L, is the catalytic subunit of the Integrator complex (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 probably benign Het
9030619P08Rik T A 15: 75,431,418 noncoding transcript Het
9030624J02Rik T C 7: 118,780,268 I426T possibly damaging Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abcb1b A T 5: 8,812,671 T118S probably benign Het
Abcb1b T A 5: 8,861,602 I133N probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Ankmy2 A G 12: 36,186,918 K242E possibly damaging Het
Apc2 A C 10: 80,314,007 I1603L probably benign Het
Arhgef25 T A 10: 127,185,603 I249F probably damaging Het
Birc3 T C 9: 7,860,552 H255R probably benign Het
Cables1 A T 18: 11,941,277 R486W possibly damaging Het
Caskin1 A T 17: 24,507,161 D1414V probably damaging Het
Ccdc175 A G 12: 72,180,845 S55P probably damaging Het
Ccdc57 A T 11: 120,861,152 S868T probably benign Het
Ccny A T 18: 9,449,516 probably null Het
Cdc34b A T 11: 94,742,261 I96F probably damaging Het
Ctnnd1 A G 2: 84,622,073 F69L possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Cyb5rl A G 4: 107,069,132 probably benign Het
Ddx18 T C 1: 121,566,094 K54E probably benign Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dlg1 C T 16: 31,754,808 T9I probably benign Het
Dnase1 T C 16: 4,037,907 probably benign Het
Drd4 T C 7: 141,293,777 M114T probably damaging Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Eif2s1 T A 12: 78,880,011 N178K probably benign Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Galntl6 T C 8: 58,699,911 probably benign Het
Glipr1l2 T A 10: 112,106,999 I253K possibly damaging Het
Gnat1 A T 9: 107,677,234 M115K probably benign Het
Gtsf2 T C 15: 103,444,328 E88G possibly damaging Het
Hormad1 T A 3: 95,585,220 probably null Het
Hydin A T 8: 110,490,673 I1398F possibly damaging Het
Ifnar1 T C 16: 91,505,086 V483A probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Krt7 C T 15: 101,413,972 R104C probably damaging Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mef2d T A 3: 88,168,097 I422N probably damaging Het
Mipep G T 14: 60,784,782 R32L probably damaging Het
Mon1a A G 9: 107,902,651 E473G probably damaging Het
Mterf2 T A 10: 85,120,115 Q215L probably damaging Het
Mybpc1 T A 10: 88,555,663 Y324F probably benign Het
Myh11 T C 16: 14,205,954 E1512G probably damaging Het
Myo1g A T 11: 6,515,976 F370I probably damaging Het
Myo5c T A 9: 75,297,509 M1548K possibly damaging Het
Myof T A 19: 37,935,852 I1306F probably damaging Het
Nle1 A G 11: 82,908,192 F21S probably damaging Het
Noc2l C G 4: 156,245,911 D513E probably damaging Het
Olfr23 A T 11: 73,941,202 I319F probably benign Het
Olfr30 A G 11: 58,455,907 V14A probably benign Het
Orc1 T C 4: 108,614,473 *841R probably null Het
Patz1 A G 11: 3,307,720 D573G probably damaging Het
Pcdhga3 A G 18: 37,676,101 T536A probably benign Het
Pde6h C T 6: 136,961,203 T58I possibly damaging Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pkd1 T C 17: 24,586,068 probably null Het
Polr1e G A 4: 45,029,429 A297T probably damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Ryr2 T C 13: 11,714,611 E2375G possibly damaging Het
Ryr2 T C 13: 11,833,992 T361A probably benign Het
Serpina3m T C 12: 104,389,101 I9T probably benign Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Sf3b1 T C 1: 54,999,712 N804S probably benign Het
Shroom1 A G 11: 53,465,172 T350A probably benign Het
Slc24a5 G A 2: 125,068,268 V30I probably benign Het
Slc38a8 A T 8: 119,482,684 probably null Het
Smarcd1 A G 15: 99,707,981 S378G possibly damaging Het
Stx1b T C 7: 127,807,921 I55V probably damaging Het
Sult2a8 A G 7: 14,425,532 V54A probably damaging Het
Tacc2 T C 7: 130,728,777 S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 I114T probably benign Het
Tmco6 T C 18: 36,735,502 probably null Het
Treh T C 9: 44,682,648 L144P probably damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Ttbk2 A T 2: 120,773,277 F258L possibly damaging Het
Ttn T C 2: 76,955,036 D665G probably damaging Het
Unc93b1 T C 19: 3,942,023 probably null Het
Uroc1 T C 6: 90,345,394 L300P probably damaging Het
Xbp1 A G 11: 5,521,125 E44G probably damaging Het
Zfp451 A T 1: 33,777,861 V119D probably damaging Het
Zfp457 T A 13: 67,293,278 H315L probably damaging Het
Zfp518a T A 19: 40,915,851 V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 L171R probably benign Het
Zfp712 C T 13: 67,040,612 C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 N67S probably benign Het
Other mutations in Ints11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Ints11 APN 4 155885126 missense probably damaging 1.00
IGL01515:Ints11 APN 4 155875232 missense probably damaging 1.00
IGL01613:Ints11 APN 4 155885198 critical splice donor site probably null
IGL02024:Ints11 APN 4 155888515 missense probably damaging 1.00
IGL02127:Ints11 APN 4 155886863 missense probably damaging 1.00
IGL02850:Ints11 APN 4 155875304 missense probably benign 0.03
IGL02926:Ints11 APN 4 155888111 critical splice donor site probably null
IGL03296:Ints11 APN 4 155885323 critical splice donor site probably null
IGL03357:Ints11 APN 4 155872124 splice site probably benign
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0449:Ints11 UTSW 4 155887948 missense probably benign 0.17
R0480:Ints11 UTSW 4 155887624 missense probably damaging 1.00
R0589:Ints11 UTSW 4 155886886 missense probably damaging 1.00
R0678:Ints11 UTSW 4 155887753 missense probably damaging 1.00
R0865:Ints11 UTSW 4 155887107 splice site probably null
R1135:Ints11 UTSW 4 155887927 splice site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1658:Ints11 UTSW 4 155887728 missense probably damaging 0.97
R1707:Ints11 UTSW 4 155875198 missense probably benign 0.21
R2199:Ints11 UTSW 4 155875281 missense probably benign 0.07
R2876:Ints11 UTSW 4 155887425 unclassified probably benign
R4567:Ints11 UTSW 4 155885675 missense probably damaging 1.00
R4900:Ints11 UTSW 4 155888430 missense probably benign 0.01
R4966:Ints11 UTSW 4 155886928 missense probably damaging 1.00
R5306:Ints11 UTSW 4 155875208 missense probably damaging 1.00
R5963:Ints11 UTSW 4 155872912 nonsense probably null
R6246:Ints11 UTSW 4 155888089 missense probably benign
R7285:Ints11 UTSW 4 155886111 missense probably damaging 1.00
R7365:Ints11 UTSW 4 155872230 splice site probably null
R7768:Ints11 UTSW 4 155886939 missense probably damaging 0.97
R7774:Ints11 UTSW 4 155885683 missense probably benign 0.00
R7999:Ints11 UTSW 4 155886956 missense probably benign 0.12
R8103:Ints11 UTSW 4 155888230 missense possibly damaging 0.93
R8785:Ints11 UTSW 4 155869708 missense probably benign 0.17
R8825:Ints11 UTSW 4 155885130 nonsense probably null
Z1088:Ints11 UTSW 4 155886970 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGGCCTCCACATACTGACTG -3'
(R):5'- AGATTTGCAGGGATTGGCC -3'

Sequencing Primer
(F):5'- CTCCACATACTGACTGGGTTGG -3'
(R):5'- ATCCCAGGTGTGGCAAAC -3'
Posted On2016-04-27