Mutagenetix > Incidental Mutation

Incidental Mutation 'R4965:Mcm6'

383857

Institutional Source

Beutler Lab

Gene Symbol

Mcm6

Ensembl Gene

ENSMUSG00000026355

Gene Name

minichromosome maintenance complex component 6

Synonyms

D1Wsu22e, Mcmd6

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4965 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

128331590-128359664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128359486 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 27 (Q27L)

Ref Sequence

ENSEMBL: ENSMUSP00000140308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000027602] [ENSMUST00000190495]

AlphaFold

P97311

Predicted Effect

probably damaging
Transcript: ENSMUST00000027601
AA Change: Q27L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: Q27L

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	821	1e-47	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000027602

SMART Domains

Protein: ENSMUSP00000027602
Gene: ENSMUSG00000026356

Domain	Start	End	E-Value	Type
Pfam:tRNA_anti-codon	60	145	4.6e-10	PFAM
Pfam:tRNA-synt_2	175	496	2.3e-77	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000190495
AA Change: Q27L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: Q27L

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	783	3e-29	PDB

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,069,672	T1541A	probably benign	Het
2810474O19Rik	G	T	6: 149,328,398	G981*	probably null	Het
4931423N10Rik	C	A	2: 23,245,115	T312K	probably benign	Het
9530002B09Rik	T	C	4: 122,700,492	M59T	probably benign	Het
Adam18	C	T	8: 24,641,811	C428Y	probably damaging	Het
Adcy5	A	G	16: 35,278,502	E700G	possibly damaging	Het
Adprh	G	T	16: 38,445,780	Y333*	probably null	Het
Agfg2	C	A	5: 137,667,177		probably null	Het
Akip1	A	T	7: 109,711,754	E167V	probably damaging	Het
Akr1c21	A	T	13: 4,580,305	Q199L	probably damaging	Het
Aldh9a1	C	A	1: 167,365,789	A455E	probably damaging	Het
Amph	G	A	13: 19,137,699	S520N	probably benign	Het
Ankrd52	A	G	10: 128,390,507	D1006G	probably benign	Het
Ap5z1	A	C	5: 142,467,676	Q133P	probably damaging	Het
Babam1	C	T	8: 71,404,388	A331V	possibly damaging	Het
Btc	T	C	5: 91,362,301		probably null	Het
Cacna2d3	A	G	14: 28,982,332	F831L	probably benign	Het
Cadm3	G	A	1: 173,337,097	P372L	probably damaging	Het
Capn5	A	T	7: 98,126,417	M439K	probably damaging	Het
Carf	T	C	1: 60,150,637	S639P	probably damaging	Het
Casp12	C	T	9: 5,352,250	R81C	probably benign	Het
Ces2e	G	T	8: 104,933,698	R555M	probably benign	Het
Cfap54	T	A	10: 93,066,799	I164F	probably benign	Het
Cltc	C	T	11: 86,707,501	V1012I	probably damaging	Het
Cmya5	G	A	13: 93,095,787	T931I	possibly damaging	Het
Cntn6	A	G	6: 104,774,474	I364V	probably damaging	Het
Cntnap1	A	T	11: 101,177,425	I59F	possibly damaging	Het
Cop1	T	C	1: 159,239,597	M80T	probably damaging	Het
Cplx2	A	G	13: 54,379,647	S115G	possibly damaging	Het
Crtac1	A	G	19: 42,318,740	Y195H	probably damaging	Het
Csn1s2a	A	C	5: 87,781,838	S99R	possibly damaging	Het
Csn1s2b	T	A	5: 87,813,961	D41E	possibly damaging	Het
Cul9	C	T	17: 46,538,525	D565N	probably damaging	Het
Cux1	A	T	5: 136,311,556	N625K	possibly damaging	Het
Cyp2c37	A	T	19: 40,011,762	M443L	possibly damaging	Het
Cyp2s1	G	A	7: 25,809,285	T244I	possibly damaging	Het
Dgkh	C	T	14: 78,624,421	V135M	probably damaging	Het
Dtl	T	C	1: 191,546,565	E395G	possibly damaging	Het
Dyrk1a	G	T	16: 94,691,995	G658*	probably null	Het
Erlin2	T	C	8: 27,029,595	F117S	probably damaging	Het
Fkbp8	A	G	8: 70,531,523		probably null	Het
Fras1	T	C	5: 96,726,580	F2288S	possibly damaging	Het
Frmd3	A	G	4: 74,153,600	T240A	probably damaging	Het
H2-D1	A	G	17: 35,263,905	Y137C	probably damaging	Het
Helz2	A	G	2: 181,240,916	V28A	possibly damaging	Het
Hydin	A	G	8: 110,398,095	I579V	probably benign	Het
Il6	A	T	5: 30,013,493	Y29F	possibly damaging	Het
Ildr2	A	G	1: 166,307,840	D368G	probably damaging	Het
Junb	T	A	8: 84,978,159	I91F	probably damaging	Het
Kat2a	C	A	11: 100,712,203		probably benign	Het
Kat2a	A	T	11: 100,712,204		probably benign	Het
Kcnh5	T	A	12: 74,965,151	T665S	probably benign	Het
Kdm1b	A	T	13: 47,074,367	D608V	probably damaging	Het
Krcc1	A	G	6: 71,284,637	K218E	probably damaging	Het
Krt8	C	T	15: 101,996,951	V488M	probably benign	Het
Lzts1	C	T	8: 69,138,762	A245T	probably benign	Het
Mfsd4b3	G	T	10: 39,947,690	Y191*	probably null	Het
Mgme1	T	C	2: 144,279,620	L332P	probably benign	Het
Mgme1	C	T	2: 144,276,404	Q199*	probably null	Het
Morc3	G	T	16: 93,860,587	E25*	probably null	Het
Mroh7	G	A	4: 106,690,987	A1098V	possibly damaging	Het
Mtrf1	G	A	14: 79,406,587	R174H	probably benign	Het
Mybpc3	G	A	2: 91,119,247	G45D	possibly damaging	Het
Mycbpap	A	T	11: 94,504,938	N733K	probably damaging	Het
N4bp1	T	C	8: 86,851,686	I684V	possibly damaging	Het
Nav2	A	T	7: 49,552,877	R1470*	probably null	Het
Ndufa9	A	T	6: 126,822,063	S364T	probably benign	Het
Nipal4	C	A	11: 46,162,010	A43S	possibly damaging	Het
Nlrp1a	T	A	11: 71,092,315	Y1275F	possibly damaging	Het
Nova1	A	T	12: 46,720,835	L8*	probably null	Het
Odam	G	T	5: 87,890,108	G181*	probably null	Het
Olfr1111	T	A	2: 87,150,659	M1L	possibly damaging	Het
Olfr1297	T	C	2: 111,621,534	D180G	probably damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Olfr186	A	T	16: 59,027,333	D191E	probably damaging	Het
Olfr283	T	C	15: 98,379,149		probably benign	Het
Olfr33	A	T	7: 102,713,495	I306N	probably damaging	Het
Olfr723	C	T	14: 49,928,897	V216I	probably benign	Het
Optn	T	A	2: 5,021,379	Q576L	probably benign	Het
Patl2	G	T	2: 122,128,848	S45*	probably null	Het
Pde2a	G	A	7: 101,502,933	G349E	probably benign	Het
Pdlim2	T	A	14: 70,168,015		probably benign	Het
Per1	T	C	11: 69,104,401	V653A	probably benign	Het
Phlda2	A	G	7: 143,502,268	S75P	probably damaging	Het
Poldip3	A	T	15: 83,137,505	M167K	possibly damaging	Het
Prpf38a	T	C	4: 108,579,081	I12V	probably benign	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Ptges3l	A	T	11: 101,424,622	M1K	probably null	Het
Rdh5	A	G	10: 128,913,784	Y296H	probably damaging	Het
Rnf2	T	A	1: 151,473,217	K51*	probably null	Het
Rpusd3	C	A	6: 113,416,848	R215L	probably benign	Het
Rsph4a	A	T	10: 33,909,240	E382D	probably damaging	Het
S1pr2	G	A	9: 20,968,449	Q28*	probably null	Het
Sesn1	A	T	10: 41,895,009	I179F	probably damaging	Het
Setd3	T	A	12: 108,113,371	E291V	probably benign	Het
Shc1	G	T	3: 89,426,996	R323L	probably damaging	Het
Slc22a5	T	C	11: 53,891,526	D5G	possibly damaging	Het
Slc6a19	T	C	13: 73,700,558	K26E	probably benign	Het
Slc9a3	A	G	13: 74,164,293	N670D	possibly damaging	Het
Spata19	A	T	9: 27,400,465	I127L	probably benign	Het
Speg	G	T	1: 75,427,703	V2751L	probably damaging	Het
Sptbn2	A	G	19: 4,729,309	D298G	probably benign	Het
Srm	T	C	4: 148,594,183	V289A	possibly damaging	Het
Stip1	C	T	19: 7,035,570	A49T	probably benign	Het
Tas2r118	C	A	6: 23,969,628	V145F	probably benign	Het
Tbc1d12	A	T	19: 38,865,725	K284*	probably null	Het
Tfcp2	T	C	15: 100,525,650	H125R	probably damaging	Het
Tfdp1	T	C	8: 13,373,073	V206A	probably damaging	Het
Tgtp2	A	G	11: 49,059,410	W112R	probably damaging	Het
Tmem71	T	G	15: 66,538,861	M221L	probably benign	Het
Tpcn1	T	C	5: 120,547,487	N436S	possibly damaging	Het
Usp4	C	T	9: 108,362,620	L183F	probably damaging	Het
Vmn2r55	A	T	7: 12,670,551	N308K	possibly damaging	Het
Zfp106	T	A	2: 120,533,919	D669V	probably damaging	Het
Zfp108	A	T	7: 24,260,148	I55L	probably benign	Het
Zfp512b	A	T	2: 181,586,338	S8R	probably damaging	Het
Zfp827	T	C	8: 79,061,281	S359P	probably benign	Het

Other mutations in Mcm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Mcm6	APN	1	128344383	missense	probably damaging	1.00
IGL01420:Mcm6	APN	1	128345875	missense	probably damaging	1.00
IGL01746:Mcm6	APN	1	128353524	nonsense	probably null
IGL02256:Mcm6	APN	1	128335728	critical splice donor site	probably null
IGL02624:Mcm6	APN	1	128349448	missense	possibly damaging	0.91
IGL02732:Mcm6	APN	1	128359490	missense	probably benign	0.16
IGL02750:Mcm6	APN	1	128343472	missense	probably damaging	1.00
IGL02926:Mcm6	APN	1	128339382	missense	probably damaging	1.00
IGL03189:Mcm6	APN	1	128344302	missense	probably damaging	1.00
IGL03238:Mcm6	APN	1	128355520	missense	probably benign	0.13
IGL03397:Mcm6	APN	1	128344302	missense	probably damaging	1.00
R0453:Mcm6	UTSW	1	128333555	missense	probably benign	0.00
R0501:Mcm6	UTSW	1	128355636	missense	probably benign	0.03
R0885:Mcm6	UTSW	1	128348933	missense	probably benign	0.00
R1013:Mcm6	UTSW	1	128349041	missense	probably benign
R1319:Mcm6	UTSW	1	128349052	missense	probably benign
R1396:Mcm6	UTSW	1	128351476	missense	probably damaging	1.00
R1656:Mcm6	UTSW	1	128349418	missense	possibly damaging	0.90
R1891:Mcm6	UTSW	1	128335810	missense	probably damaging	1.00
R1950:Mcm6	UTSW	1	128345989	missense	probably benign	0.35
R3411:Mcm6	UTSW	1	128351585	missense	probably benign	0.35
R4564:Mcm6	UTSW	1	128343459	missense	probably damaging	1.00
R4626:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4627:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4628:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4916:Mcm6	UTSW	1	128348977	missense	probably damaging	1.00
R4967:Mcm6	UTSW	1	128335849	missense	probably damaging	1.00
R5016:Mcm6	UTSW	1	128343427	missense	probably damaging	1.00
R5204:Mcm6	UTSW	1	128333638	missense	probably benign	0.01
R5229:Mcm6	UTSW	1	128333584	missense	possibly damaging	0.82
R5607:Mcm6	UTSW	1	128355589	missense	probably damaging	1.00
R5811:Mcm6	UTSW	1	128335728	critical splice donor site	probably benign
R5816:Mcm6	UTSW	1	128348455	missense	probably benign	0.01
R7204:Mcm6	UTSW	1	128338127	missense	probably damaging	1.00
R7316:Mcm6	UTSW	1	128359508	missense	probably damaging	1.00
R8081:Mcm6	UTSW	1	128338168	missense	probably damaging	1.00
R8546:Mcm6	UTSW	1	128345948	missense	possibly damaging	0.91
R8547:Mcm6	UTSW	1	128345948	missense	possibly damaging	0.91
R8549:Mcm6	UTSW	1	128345948	missense	possibly damaging	0.91
R8785:Mcm6	UTSW	1	128334798	missense	probably benign	0.15
R8878:Mcm6	UTSW	1	128355511	critical splice donor site	probably null
R9043:Mcm6	UTSW	1	128343494	missense	probably damaging	1.00
R9253:Mcm6	UTSW	1	128351527	missense	probably damaging	1.00
Z1088:Mcm6	UTSW	1	128344298	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCACAGTATGACACAAG -3'
(R):5'- TCCTACCCTGTTATTGGCTGAG -3'

Sequencing Primer
(F):5'- ACACAAGGGAGCGCTGC -3'
(R):5'- CTACCCTGTTATTGGCTGAGGTGAG -3'

Posted On

2016-04-27