Incidental Mutation 'R4965:Csn1s2b'
ID 383890
Institutional Source Beutler Lab
Gene Symbol Csn1s2b
Ensembl Gene ENSMUSG00000061388
Gene Name casein alpha s2-like B
Synonyms Csne, Csnd
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R4965 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 87955980-87972280 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87961820 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 41 (D41E)
Ref Sequence ENSEMBL: ENSMUSP00000098618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072539] [ENSMUST00000101057] [ENSMUST00000113279] [ENSMUST00000197301]
AlphaFold P02664
Predicted Effect possibly damaging
Transcript: ENSMUST00000072539
AA Change: D41E

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072352
Gene: ENSMUSG00000061388
AA Change: D41E

DomainStartEndE-ValueType
Pfam:Casein 58 136 4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101057
AA Change: D41E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000113279
AA Change: D41E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108904
Gene: ENSMUSG00000061388
AA Change: D41E

DomainStartEndE-ValueType
Pfam:Casein 55 133 5.1e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197301
AA Change: D41E

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142449
Gene: ENSMUSG00000061388
AA Change: D41E

DomainStartEndE-ValueType
Pfam:Casein 45 127 7.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200098
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the alpha-s2-like casein gene family, and this gene product is a calcium-sensitive casein. Members of this gene family are organized as a gene cluster that is conserved in its order, but with greater conservation amongst orthologs than paralogs. The protein encoded by this gene interacts with other casein proteins to form a micelle structure, and is a major source of protein in milk. This structure is important for the transport of calcium, phosphate, and protein. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,775,433 (GRCm39) T1541A probably benign Het
9530002B09Rik T C 4: 122,594,285 (GRCm39) M59T probably benign Het
Adam18 C T 8: 25,131,827 (GRCm39) C428Y probably damaging Het
Adcy5 A G 16: 35,098,872 (GRCm39) E700G possibly damaging Het
Adprh G T 16: 38,266,142 (GRCm39) Y333* probably null Het
Agfg2 C A 5: 137,665,439 (GRCm39) probably null Het
Akip1 A T 7: 109,310,961 (GRCm39) E167V probably damaging Het
Akr1c21 A T 13: 4,630,304 (GRCm39) Q199L probably damaging Het
Aldh9a1 C A 1: 167,193,358 (GRCm39) A455E probably damaging Het
Amph G A 13: 19,321,869 (GRCm39) S520N probably benign Het
Ankrd52 A G 10: 128,226,376 (GRCm39) D1006G probably benign Het
Ap5z1 A C 5: 142,453,431 (GRCm39) Q133P probably damaging Het
Babam1 C T 8: 71,857,032 (GRCm39) A331V possibly damaging Het
Btc T C 5: 91,510,160 (GRCm39) probably null Het
Cacna2d3 A G 14: 28,704,289 (GRCm39) F831L probably benign Het
Cadm3 G A 1: 173,164,664 (GRCm39) P372L probably damaging Het
Capn5 A T 7: 97,775,624 (GRCm39) M439K probably damaging Het
Carf T C 1: 60,189,796 (GRCm39) S639P probably damaging Het
Casp12 C T 9: 5,352,250 (GRCm39) R81C probably benign Het
Ces2e G T 8: 105,660,330 (GRCm39) R555M probably benign Het
Cfap54 T A 10: 92,902,661 (GRCm39) I164F probably benign Het
Cltc C T 11: 86,598,327 (GRCm39) V1012I probably damaging Het
Cmya5 G A 13: 93,232,295 (GRCm39) T931I possibly damaging Het
Cntn6 A G 6: 104,751,435 (GRCm39) I364V probably damaging Het
Cntnap1 A T 11: 101,068,251 (GRCm39) I59F possibly damaging Het
Cop1 T C 1: 159,067,167 (GRCm39) M80T probably damaging Het
Cplx2 A G 13: 54,527,460 (GRCm39) S115G possibly damaging Het
Crtac1 A G 19: 42,307,179 (GRCm39) Y195H probably damaging Het
Csn1s2a A C 5: 87,929,697 (GRCm39) S99R possibly damaging Het
Cul9 C T 17: 46,849,451 (GRCm39) D565N probably damaging Het
Cux1 A T 5: 136,340,410 (GRCm39) N625K possibly damaging Het
Cyp2c37 A T 19: 40,000,206 (GRCm39) M443L possibly damaging Het
Cyp2s1 G A 7: 25,508,710 (GRCm39) T244I possibly damaging Het
Dgkh C T 14: 78,861,861 (GRCm39) V135M probably damaging Het
Dtl T C 1: 191,278,677 (GRCm39) E395G possibly damaging Het
Dyrk1a G T 16: 94,492,854 (GRCm39) G658* probably null Het
Erlin2 T C 8: 27,519,623 (GRCm39) F117S probably damaging Het
Fkbp8 A G 8: 70,984,173 (GRCm39) probably null Het
Fras1 T C 5: 96,874,439 (GRCm39) F2288S possibly damaging Het
Frmd3 A G 4: 74,071,837 (GRCm39) T240A probably damaging Het
H2-D1 A G 17: 35,482,881 (GRCm39) Y137C probably damaging Het
Helz2 A G 2: 180,882,709 (GRCm39) V28A possibly damaging Het
Hydin A G 8: 111,124,727 (GRCm39) I579V probably benign Het
Il6 A T 5: 30,218,491 (GRCm39) Y29F possibly damaging Het
Ildr2 A G 1: 166,135,409 (GRCm39) D368G probably damaging Het
Junb T A 8: 85,704,788 (GRCm39) I91F probably damaging Het
Kat2a C A 11: 100,603,029 (GRCm39) probably benign Het
Kat2a A T 11: 100,603,030 (GRCm39) probably benign Het
Kcnh5 T A 12: 75,011,925 (GRCm39) T665S probably benign Het
Kdm1b A T 13: 47,227,843 (GRCm39) D608V probably damaging Het
Krcc1 A G 6: 71,261,621 (GRCm39) K218E probably damaging Het
Krt8 C T 15: 101,905,386 (GRCm39) V488M probably benign Het
Lzts1 C T 8: 69,591,414 (GRCm39) A245T probably benign Het
Mcm6 T A 1: 128,287,223 (GRCm39) Q27L probably damaging Het
Mfsd4b3-ps G T 10: 39,823,686 (GRCm39) Y191* probably null Het
Mgme1 C T 2: 144,118,324 (GRCm39) Q199* probably null Het
Mgme1 T C 2: 144,121,540 (GRCm39) L332P probably benign Het
Morc3 G T 16: 93,657,475 (GRCm39) E25* probably null Het
Mroh7 G A 4: 106,548,184 (GRCm39) A1098V possibly damaging Het
Mtrf1 G A 14: 79,644,027 (GRCm39) R174H probably benign Het
Mybpc3 G A 2: 90,949,592 (GRCm39) G45D possibly damaging Het
Mycbpap A T 11: 94,395,764 (GRCm39) N733K probably damaging Het
N4bp1 T C 8: 87,578,314 (GRCm39) I684V possibly damaging Het
Nav2 A T 7: 49,202,625 (GRCm39) R1470* probably null Het
Ndufa9 A T 6: 126,799,026 (GRCm39) S364T probably benign Het
Nipal4 C A 11: 46,052,837 (GRCm39) A43S possibly damaging Het
Nlrp1a T A 11: 70,983,141 (GRCm39) Y1275F possibly damaging Het
Nova1 A T 12: 46,767,618 (GRCm39) L8* probably null Het
Odam G T 5: 88,037,967 (GRCm39) G181* probably null Het
Optn T A 2: 5,026,190 (GRCm39) Q576L probably benign Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or4k47 T C 2: 111,451,879 (GRCm39) D180G probably damaging Het
Or4l1 C T 14: 50,166,354 (GRCm39) V216I probably benign Het
Or51a39 A T 7: 102,362,702 (GRCm39) I306N probably damaging Het
Or5as1 T A 2: 86,981,003 (GRCm39) M1L possibly damaging Het
Or5h18 A T 16: 58,847,696 (GRCm39) D191E probably damaging Het
Or8s2 T C 15: 98,277,030 (GRCm39) probably benign Het
Patl2 G T 2: 121,959,329 (GRCm39) S45* probably null Het
Pde2a G A 7: 101,152,140 (GRCm39) G349E probably benign Het
Pdlim2 T A 14: 70,405,464 (GRCm39) probably benign Het
Per1 T C 11: 68,995,227 (GRCm39) V653A probably benign Het
Phlda2 A G 7: 143,056,005 (GRCm39) S75P probably damaging Het
Poldip3 A T 15: 83,021,706 (GRCm39) M167K possibly damaging Het
Potegl C A 2: 23,135,127 (GRCm39) T312K probably benign Het
Prpf38a T C 4: 108,436,278 (GRCm39) I12V probably benign Het
Prrc1 G A 18: 57,507,622 (GRCm39) V259I possibly damaging Het
Ptges3l A T 11: 101,315,448 (GRCm39) M1K probably null Het
Rdh5 A G 10: 128,749,653 (GRCm39) Y296H probably damaging Het
Resf1 G T 6: 149,229,896 (GRCm39) G981* probably null Het
Rnf2 T A 1: 151,348,968 (GRCm39) K51* probably null Het
Rpusd3 C A 6: 113,393,809 (GRCm39) R215L probably benign Het
Rsph4a A T 10: 33,785,236 (GRCm39) E382D probably damaging Het
S1pr2 G A 9: 20,879,745 (GRCm39) Q28* probably null Het
Sesn1 A T 10: 41,771,005 (GRCm39) I179F probably damaging Het
Setd3 T A 12: 108,079,630 (GRCm39) E291V probably benign Het
Shc1 G T 3: 89,334,303 (GRCm39) R323L probably damaging Het
Slc22a5 T C 11: 53,782,352 (GRCm39) D5G possibly damaging Het
Slc6a19 T C 13: 73,848,677 (GRCm39) K26E probably benign Het
Slc9a3 A G 13: 74,312,412 (GRCm39) N670D possibly damaging Het
Spata19 A T 9: 27,311,761 (GRCm39) I127L probably benign Het
Speg G T 1: 75,404,347 (GRCm39) V2751L probably damaging Het
Sptbn2 A G 19: 4,779,337 (GRCm39) D298G probably benign Het
Srm T C 4: 148,678,640 (GRCm39) V289A possibly damaging Het
Stip1 C T 19: 7,012,938 (GRCm39) A49T probably benign Het
Tas2r118 C A 6: 23,969,627 (GRCm39) V145F probably benign Het
Tbc1d12 A T 19: 38,854,169 (GRCm39) K284* probably null Het
Tfcp2 T C 15: 100,423,531 (GRCm39) H125R probably damaging Het
Tfdp1 T C 8: 13,423,073 (GRCm39) V206A probably damaging Het
Tgtp2 A G 11: 48,950,237 (GRCm39) W112R probably damaging Het
Tmem71 T G 15: 66,410,710 (GRCm39) M221L probably benign Het
Tpcn1 T C 5: 120,685,552 (GRCm39) N436S possibly damaging Het
Usp4 C T 9: 108,239,819 (GRCm39) L183F probably damaging Het
Vmn2r55 A T 7: 12,404,478 (GRCm39) N308K possibly damaging Het
Zfp106 T A 2: 120,364,400 (GRCm39) D669V probably damaging Het
Zfp108 A T 7: 23,959,573 (GRCm39) I55L probably benign Het
Zfp512b A T 2: 181,228,131 (GRCm39) S8R probably damaging Het
Zfp827 T C 8: 79,787,910 (GRCm39) S359P probably benign Het
Other mutations in Csn1s2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Csn1s2b APN 5 87,968,810 (GRCm39) nonsense probably null
IGL01704:Csn1s2b APN 5 87,960,970 (GRCm39) missense probably damaging 1.00
IGL01785:Csn1s2b APN 5 87,957,772 (GRCm39) missense possibly damaging 0.91
IGL02689:Csn1s2b APN 5 87,957,780 (GRCm39) missense probably benign 0.41
R1596:Csn1s2b UTSW 5 87,966,917 (GRCm39) splice site probably benign
R1649:Csn1s2b UTSW 5 87,966,943 (GRCm39) missense probably benign 0.07
R1682:Csn1s2b UTSW 5 87,970,162 (GRCm39) missense probably damaging 0.98
R1747:Csn1s2b UTSW 5 87,964,529 (GRCm39) splice site probably benign
R3123:Csn1s2b UTSW 5 87,966,917 (GRCm39) splice site probably benign
R4667:Csn1s2b UTSW 5 87,970,170 (GRCm39) missense possibly damaging 0.53
R4781:Csn1s2b UTSW 5 87,966,952 (GRCm39) missense possibly damaging 0.77
R6013:Csn1s2b UTSW 5 87,972,098 (GRCm39) splice site probably null
R6730:Csn1s2b UTSW 5 87,970,127 (GRCm39) missense probably benign 0.00
R8028:Csn1s2b UTSW 5 87,966,951 (GRCm39) missense probably benign 0.01
R9651:Csn1s2b UTSW 5 87,968,820 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAGAGCGAAACTTTTATAAACTTTGC -3'
(R):5'- AAAATGGTTTACAAATCCCTTCCTG -3'

Sequencing Primer
(F):5'- TGGATTGAAACTTTGTAGGTAATGC -3'
(R):5'- CTTCCTGGGGCTTCTCTATAGTAG -3'
Posted On 2016-04-27