Mutagenetix > Incidental Mutation

Incidental Mutation 'R4965:Cux1'

383895

Institutional Source

Beutler Lab

Gene Symbol

Cux1

Ensembl Gene

ENSMUSG00000029705

Gene Name

cut-like homeobox 1

Synonyms

Cux-1, Cutl1, CDP, Cux

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R4965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136248135-136567490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 136311556 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 625 (N625K)

Ref Sequence

ENSEMBL: ENSMUSP00000135892 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176423] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004097
AA Change: N542K

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: N542K

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
CUT	452	538	5.06e-39	SMART
low complexity region	602	608	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
CUT	841	929	3.31e-43	SMART
low complexity region	956	972	N/A	INTRINSIC
low complexity region	990	1011	N/A	INTRINSIC
CUT	1024	1110	3.78e-38	SMART
HOX	1150	1212	6.32e-15	SMART
low complexity region	1224	1239	N/A	INTRINSIC
low complexity region	1317	1379	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148082

Predicted Effect

probably benign
Transcript: ENSMUST00000175918

SMART Domains

Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	73	328	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175975

SMART Domains

Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	169	N/A	INTRINSIC
low complexity region	235	251	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	331	342	N/A	INTRINSIC
CUT	358	444	5.06e-39	SMART
low complexity region	508	514	N/A	INTRINSIC
low complexity region	526	548	N/A	INTRINSIC
CUT	747	835	3.31e-43	SMART
low complexity region	862	878	N/A	INTRINSIC
low complexity region	896	917	N/A	INTRINSIC
CUT	930	1016	3.78e-38	SMART
HOX	1056	1118	6.32e-15	SMART
low complexity region	1130	1145	N/A	INTRINSIC
low complexity region	1223	1285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175998

SMART Domains

Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
Pfam:CASP_C	204	430	8.6e-72	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176172
AA Change: N633K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: N633K

Domain	Start	End	E-Value	Type
coiled coil region	99	354	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC
low complexity region	462	474	N/A	INTRINSIC
low complexity region	516	527	N/A	INTRINSIC
CUT	543	629	5.06e-39	SMART
low complexity region	693	699	N/A	INTRINSIC
low complexity region	711	733	N/A	INTRINSIC
CUT	932	1020	3.31e-43	SMART
low complexity region	1047	1063	N/A	INTRINSIC
low complexity region	1081	1102	N/A	INTRINSIC
CUT	1115	1201	3.78e-38	SMART
HOX	1241	1303	6.32e-15	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1408	1470	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176216

SMART Domains

Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	9.35e-5	PROSPERO
Pfam:CASP_C	421	647	1.2e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176423

SMART Domains

Protein: ENSMUSP00000135036
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
low complexity region	217	226	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000176486
AA Change: N504K

SMART Domains

Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: N504K

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
low complexity region	429	445	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
low complexity region	525	536	N/A	INTRINSIC
CUT	552	638	5.06e-39	SMART
Blast:CUT	641	840	3e-50	BLAST
CUT	919	1007	3.31e-43	SMART
low complexity region	1034	1050	N/A	INTRINSIC
low complexity region	1068	1089	N/A	INTRINSIC
CUT	1102	1188	3.78e-38	SMART
HOX	1228	1290	6.32e-15	SMART
low complexity region	1302	1317	N/A	INTRINSIC
low complexity region	1395	1457	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176745

SMART Domains

Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
internal_repeat_1	367	388	8.95e-5	PROSPERO
Pfam:CASP_C	419	645	1.2e-71	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176778
AA Change: N625K

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: N625K

Domain	Start	End	E-Value	Type
low complexity region	78	86	N/A	INTRINSIC
coiled coil region	195	448	N/A	INTRINSIC
low complexity region	508	519	N/A	INTRINSIC
CUT	535	621	5.06e-39	SMART
low complexity region	685	691	N/A	INTRINSIC
low complexity region	703	725	N/A	INTRINSIC
CUT	924	1012	3.31e-43	SMART
low complexity region	1039	1055	N/A	INTRINSIC
low complexity region	1073	1094	N/A	INTRINSIC
CUT	1107	1193	3.78e-38	SMART
HOX	1233	1295	6.32e-15	SMART
low complexity region	1307	1322	N/A	INTRINSIC
low complexity region	1400	1462	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177297

SMART Domains

Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	8.99e-6	PROSPERO
Pfam:CASP_C	422	527	1.8e-17	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,069,672	T1541A	probably benign	Het
2810474O19Rik	G	T	6: 149,328,398	G981*	probably null	Het
4931423N10Rik	C	A	2: 23,245,115	T312K	probably benign	Het
9530002B09Rik	T	C	4: 122,700,492	M59T	probably benign	Het
Adam18	C	T	8: 24,641,811	C428Y	probably damaging	Het
Adcy5	A	G	16: 35,278,502	E700G	possibly damaging	Het
Adprh	G	T	16: 38,445,780	Y333*	probably null	Het
Agfg2	C	A	5: 137,667,177		probably null	Het
Akip1	A	T	7: 109,711,754	E167V	probably damaging	Het
Akr1c21	A	T	13: 4,580,305	Q199L	probably damaging	Het
Aldh9a1	C	A	1: 167,365,789	A455E	probably damaging	Het
Amph	G	A	13: 19,137,699	S520N	probably benign	Het
Ankrd52	A	G	10: 128,390,507	D1006G	probably benign	Het
Ap5z1	A	C	5: 142,467,676	Q133P	probably damaging	Het
Babam1	C	T	8: 71,404,388	A331V	possibly damaging	Het
Btc	T	C	5: 91,362,301		probably null	Het
Cacna2d3	A	G	14: 28,982,332	F831L	probably benign	Het
Cadm3	G	A	1: 173,337,097	P372L	probably damaging	Het
Capn5	A	T	7: 98,126,417	M439K	probably damaging	Het
Carf	T	C	1: 60,150,637	S639P	probably damaging	Het
Casp12	C	T	9: 5,352,250	R81C	probably benign	Het
Ces2e	G	T	8: 104,933,698	R555M	probably benign	Het
Cfap54	T	A	10: 93,066,799	I164F	probably benign	Het
Cltc	C	T	11: 86,707,501	V1012I	probably damaging	Het
Cmya5	G	A	13: 93,095,787	T931I	possibly damaging	Het
Cntn6	A	G	6: 104,774,474	I364V	probably damaging	Het
Cntnap1	A	T	11: 101,177,425	I59F	possibly damaging	Het
Cop1	T	C	1: 159,239,597	M80T	probably damaging	Het
Cplx2	A	G	13: 54,379,647	S115G	possibly damaging	Het
Crtac1	A	G	19: 42,318,740	Y195H	probably damaging	Het
Csn1s2a	A	C	5: 87,781,838	S99R	possibly damaging	Het
Csn1s2b	T	A	5: 87,813,961	D41E	possibly damaging	Het
Cul9	C	T	17: 46,538,525	D565N	probably damaging	Het
Cyp2c37	A	T	19: 40,011,762	M443L	possibly damaging	Het
Cyp2s1	G	A	7: 25,809,285	T244I	possibly damaging	Het
Dgkh	C	T	14: 78,624,421	V135M	probably damaging	Het
Dtl	T	C	1: 191,546,565	E395G	possibly damaging	Het
Dyrk1a	G	T	16: 94,691,995	G658*	probably null	Het
Erlin2	T	C	8: 27,029,595	F117S	probably damaging	Het
Fkbp8	A	G	8: 70,531,523		probably null	Het
Fras1	T	C	5: 96,726,580	F2288S	possibly damaging	Het
Frmd3	A	G	4: 74,153,600	T240A	probably damaging	Het
H2-D1	A	G	17: 35,263,905	Y137C	probably damaging	Het
Helz2	A	G	2: 181,240,916	V28A	possibly damaging	Het
Hydin	A	G	8: 110,398,095	I579V	probably benign	Het
Il6	A	T	5: 30,013,493	Y29F	possibly damaging	Het
Ildr2	A	G	1: 166,307,840	D368G	probably damaging	Het
Junb	T	A	8: 84,978,159	I91F	probably damaging	Het
Kat2a	C	A	11: 100,712,203		probably benign	Het
Kat2a	A	T	11: 100,712,204		probably benign	Het
Kcnh5	T	A	12: 74,965,151	T665S	probably benign	Het
Kdm1b	A	T	13: 47,074,367	D608V	probably damaging	Het
Krcc1	A	G	6: 71,284,637	K218E	probably damaging	Het
Krt8	C	T	15: 101,996,951	V488M	probably benign	Het
Lzts1	C	T	8: 69,138,762	A245T	probably benign	Het
Mcm6	T	A	1: 128,359,486	Q27L	probably damaging	Het
Mfsd4b3	G	T	10: 39,947,690	Y191*	probably null	Het
Mgme1	C	T	2: 144,276,404	Q199*	probably null	Het
Mgme1	T	C	2: 144,279,620	L332P	probably benign	Het
Morc3	G	T	16: 93,860,587	E25*	probably null	Het
Mroh7	G	A	4: 106,690,987	A1098V	possibly damaging	Het
Mtrf1	G	A	14: 79,406,587	R174H	probably benign	Het
Mybpc3	G	A	2: 91,119,247	G45D	possibly damaging	Het
Mycbpap	A	T	11: 94,504,938	N733K	probably damaging	Het
N4bp1	T	C	8: 86,851,686	I684V	possibly damaging	Het
Nav2	A	T	7: 49,552,877	R1470*	probably null	Het
Ndufa9	A	T	6: 126,822,063	S364T	probably benign	Het
Nipal4	C	A	11: 46,162,010	A43S	possibly damaging	Het
Nlrp1a	T	A	11: 71,092,315	Y1275F	possibly damaging	Het
Nova1	A	T	12: 46,720,835	L8*	probably null	Het
Odam	G	T	5: 87,890,108	G181*	probably null	Het
Olfr1111	T	A	2: 87,150,659	M1L	possibly damaging	Het
Olfr1297	T	C	2: 111,621,534	D180G	probably damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Olfr186	A	T	16: 59,027,333	D191E	probably damaging	Het
Olfr283	T	C	15: 98,379,149		probably benign	Het
Olfr33	A	T	7: 102,713,495	I306N	probably damaging	Het
Olfr723	C	T	14: 49,928,897	V216I	probably benign	Het
Optn	T	A	2: 5,021,379	Q576L	probably benign	Het
Patl2	G	T	2: 122,128,848	S45*	probably null	Het
Pde2a	G	A	7: 101,502,933	G349E	probably benign	Het
Pdlim2	T	A	14: 70,168,015		probably benign	Het
Per1	T	C	11: 69,104,401	V653A	probably benign	Het
Phlda2	A	G	7: 143,502,268	S75P	probably damaging	Het
Poldip3	A	T	15: 83,137,505	M167K	possibly damaging	Het
Prpf38a	T	C	4: 108,579,081	I12V	probably benign	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Ptges3l	A	T	11: 101,424,622	M1K	probably null	Het
Rdh5	A	G	10: 128,913,784	Y296H	probably damaging	Het
Rnf2	T	A	1: 151,473,217	K51*	probably null	Het
Rpusd3	C	A	6: 113,416,848	R215L	probably benign	Het
Rsph4a	A	T	10: 33,909,240	E382D	probably damaging	Het
S1pr2	G	A	9: 20,968,449	Q28*	probably null	Het
Sesn1	A	T	10: 41,895,009	I179F	probably damaging	Het
Setd3	T	A	12: 108,113,371	E291V	probably benign	Het
Shc1	G	T	3: 89,426,996	R323L	probably damaging	Het
Slc22a5	T	C	11: 53,891,526	D5G	possibly damaging	Het
Slc6a19	T	C	13: 73,700,558	K26E	probably benign	Het
Slc9a3	A	G	13: 74,164,293	N670D	possibly damaging	Het
Spata19	A	T	9: 27,400,465	I127L	probably benign	Het
Speg	G	T	1: 75,427,703	V2751L	probably damaging	Het
Sptbn2	A	G	19: 4,729,309	D298G	probably benign	Het
Srm	T	C	4: 148,594,183	V289A	possibly damaging	Het
Stip1	C	T	19: 7,035,570	A49T	probably benign	Het
Tas2r118	C	A	6: 23,969,628	V145F	probably benign	Het
Tbc1d12	A	T	19: 38,865,725	K284*	probably null	Het
Tfcp2	T	C	15: 100,525,650	H125R	probably damaging	Het
Tfdp1	T	C	8: 13,373,073	V206A	probably damaging	Het
Tgtp2	A	G	11: 49,059,410	W112R	probably damaging	Het
Tmem71	T	G	15: 66,538,861	M221L	probably benign	Het
Tpcn1	T	C	5: 120,547,487	N436S	possibly damaging	Het
Usp4	C	T	9: 108,362,620	L183F	probably damaging	Het
Vmn2r55	A	T	7: 12,670,551	N308K	possibly damaging	Het
Zfp106	T	A	2: 120,533,919	D669V	probably damaging	Het
Zfp108	A	T	7: 24,260,148	I55L	probably benign	Het
Zfp512b	A	T	2: 181,586,338	S8R	probably damaging	Het
Zfp827	T	C	8: 79,061,281	S359P	probably benign	Het

Other mutations in Cux1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cux1	APN	5	136326796	missense	probably damaging	1.00
IGL00966:Cux1	APN	5	136311491	intron	probably benign
IGL01129:Cux1	APN	5	136304718	intron	probably benign
IGL01885:Cux1	APN	5	136308447	missense	possibly damaging	0.90
IGL01947:Cux1	APN	5	136275125	missense	probably benign	0.04
IGL02259:Cux1	APN	5	136326833	missense	probably damaging	1.00
IGL02666:Cux1	APN	5	136275315	nonsense	probably null
IGL02826:Cux1	APN	5	136308003	missense	probably damaging	1.00
IGL03014:Cux1	UTSW	5	136565525	intron	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0057:Cux1	UTSW	5	136256282	missense	probably damaging	1.00
R0149:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0295:Cux1	UTSW	5	136313212	missense	probably benign	0.04
R0361:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0533:Cux1	UTSW	5	136307859	missense	probably damaging	1.00
R0630:Cux1	UTSW	5	136286835	missense	probably damaging	1.00
R0801:Cux1	UTSW	5	136326929	missense	probably damaging	0.97
R0884:Cux1	UTSW	5	136307835	missense	probably damaging	1.00
R0976:Cux1	UTSW	5	136313290	missense	probably damaging	1.00
R1073:Cux1	UTSW	5	136252541	critical splice donor site	probably null
R1222:Cux1	UTSW	5	136275149	missense	probably benign	0.18
R1518:Cux1	UTSW	5	136308279	missense	probably benign	0.29
R1686:Cux1	UTSW	5	136275381	nonsense	probably null
R1687:Cux1	UTSW	5	136312669	missense	probably damaging	1.00
R1758:Cux1	UTSW	5	136392322	missense	probably damaging	1.00
R1797:Cux1	UTSW	5	136275315	missense	probably benign	0.22
R1919:Cux1	UTSW	5	136363319	nonsense	probably null
R2051:Cux1	UTSW	5	136332658	missense	probably damaging	1.00
R2339:Cux1	UTSW	5	136287008	missense	probably damaging	1.00
R3438:Cux1	UTSW	5	136311560	missense	probably damaging	0.97
R3713:Cux1	UTSW	5	136565543	intron	probably benign
R3800:Cux1	UTSW	5	136316033	missense	probably damaging	1.00
R3964:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R4135:Cux1	UTSW	5	136307896	missense	probably damaging	1.00
R4198:Cux1	UTSW	5	136286848	missense	probably damaging	1.00
R4467:Cux1	UTSW	5	136312722	missense	probably damaging	1.00
R4498:Cux1	UTSW	5	136312993	missense	probably damaging	1.00
R4622:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4623:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4651:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4652:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4658:Cux1	UTSW	5	136250594	missense	possibly damaging	0.80
R4665:Cux1	UTSW	5	136286799	missense	probably damaging	1.00
R4704:Cux1	UTSW	5	136249201	missense	probably benign	0.01
R4867:Cux1	UTSW	5	136274961	intron	probably benign
R5090:Cux1	UTSW	5	136313200	missense	possibly damaging	0.95
R5155:Cux1	UTSW	5	136565441	intron	probably benign
R5226:Cux1	UTSW	5	136370173	missense	probably benign	0.01
R5252:Cux1	UTSW	5	136308297	missense	probably damaging	0.98
R5266:Cux1	UTSW	5	136312694	missense	probably damaging	1.00
R5399:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R5509:Cux1	UTSW	5	136275317	missense	probably benign	0.13
R5609:Cux1	UTSW	5	136392320	missense	probably damaging	1.00
R5681:Cux1	UTSW	5	136308184	missense	probably damaging	1.00
R5993:Cux1	UTSW	5	136363271	missense	probably benign	0.00
R6049:Cux1	UTSW	5	136332710	missense	probably damaging	1.00
R6290:Cux1	UTSW	5	136311558	missense	probably damaging	0.99
R6310:Cux1	UTSW	5	136275164	missense	probably benign	0.10
R6351:Cux1	UTSW	5	136309792	missense	probably damaging	1.00
R6531:Cux1	UTSW	5	136275119	missense	probably benign	0.03
R6590:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6663:Cux1	UTSW	5	136485847	missense	probably damaging	1.00
R6690:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6777:Cux1	UTSW	5	136565568	intron	probably benign
R6786:Cux1	UTSW	5	136567231	missense	probably damaging	1.00
R6817:Cux1	UTSW	5	136373173	splice site	probably null
R6989:Cux1	UTSW	5	136279648	nonsense	probably null
R7011:Cux1	UTSW	5	136360033	missense	probably damaging	1.00
R7167:Cux1	UTSW	5	136310041	splice site	probably null
R7699:Cux1	UTSW	5	136485739	critical splice donor site	probably null
R7861:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R7876:Cux1	UTSW	5	136363307	missense	probably benign	0.00
R7916:Cux1	UTSW	5	136282961	missense	probably damaging	1.00
R8023:Cux1	UTSW	5	136373397	missense	probably damaging	0.99
R8154:Cux1	UTSW	5	136252580	missense	probably damaging	1.00
R8267:Cux1	UTSW	5	136282999	missense	probably damaging	1.00
R8289:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8305:Cux1	UTSW	5	136360009	missense	probably benign	0.02
R8319:Cux1	UTSW	5	136565397	missense	probably benign	0.02
R8405:Cux1	UTSW	5	136275387	missense	possibly damaging	0.83
R8483:Cux1	UTSW	5	136275090	missense	possibly damaging	0.83
R8506:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8671:Cux1	UTSW	5	136250600	missense	probably damaging	1.00
R8680:Cux1	UTSW	5	136307856	missense	possibly damaging	0.46
R8737:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R8738:Cux1	UTSW	5	136373366	missense	probably damaging	1.00
R8793:Cux1	UTSW	5	136565685	missense	unknown
R8897:Cux1	UTSW	5	136286769	missense	probably damaging	1.00
R8926:Cux1	UTSW	5	136309550	intron	probably benign
R8954:Cux1	UTSW	5	136373349	nonsense	probably null
R9092:Cux1	UTSW	5	136485817	missense	probably damaging	1.00
R9205:Cux1	UTSW	5	136370135	missense	probably damaging	1.00
R9550:Cux1	UTSW	5	136311533	missense	probably damaging	0.99
R9578:Cux1	UTSW	5	136254065	critical splice donor site	probably null
R9682:Cux1	UTSW	5	136308262	missense	probably benign
R9701:Cux1	UTSW	5	136314315	missense	probably damaging	0.97
R9712:Cux1	UTSW	5	136309819	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- GCCTTTGAACCCGTGCTTTG -3'
(R):5'- TCCTCCTACAGTAGACCCAGTG -3'

Sequencing Primer
(F):5'- GTTTTTCACACCAGGTTCCAGG -3'
(R):5'- CCCAGTGCCTGTAAGAAGGTTCTAG -3'

Posted On

2016-04-27