Mutagenetix > Incidental Mutation

Incidental Mutation 'R4965:Cntn6'

383900

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R4965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104774474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 364 (I364V)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably damaging
Transcript: ENSMUST00000089215
AA Change: I364V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: I364V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161070
AA Change: I292V

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: I292V

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162872
AA Change: I364V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: I364V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,069,672	T1541A	probably benign	Het
2810474O19Rik	G	T	6: 149,328,398	G981*	probably null	Het
4931423N10Rik	C	A	2: 23,245,115	T312K	probably benign	Het
9530002B09Rik	T	C	4: 122,700,492	M59T	probably benign	Het
Adam18	C	T	8: 24,641,811	C428Y	probably damaging	Het
Adcy5	A	G	16: 35,278,502	E700G	possibly damaging	Het
Adprh	G	T	16: 38,445,780	Y333*	probably null	Het
Agfg2	C	A	5: 137,667,177		probably null	Het
Akip1	A	T	7: 109,711,754	E167V	probably damaging	Het
Akr1c21	A	T	13: 4,580,305	Q199L	probably damaging	Het
Aldh9a1	C	A	1: 167,365,789	A455E	probably damaging	Het
Amph	G	A	13: 19,137,699	S520N	probably benign	Het
Ankrd52	A	G	10: 128,390,507	D1006G	probably benign	Het
Ap5z1	A	C	5: 142,467,676	Q133P	probably damaging	Het
Babam1	C	T	8: 71,404,388	A331V	possibly damaging	Het
Btc	T	C	5: 91,362,301		probably null	Het
Cacna2d3	A	G	14: 28,982,332	F831L	probably benign	Het
Cadm3	G	A	1: 173,337,097	P372L	probably damaging	Het
Capn5	A	T	7: 98,126,417	M439K	probably damaging	Het
Carf	T	C	1: 60,150,637	S639P	probably damaging	Het
Casp12	C	T	9: 5,352,250	R81C	probably benign	Het
Ces2e	G	T	8: 104,933,698	R555M	probably benign	Het
Cfap54	T	A	10: 93,066,799	I164F	probably benign	Het
Cltc	C	T	11: 86,707,501	V1012I	probably damaging	Het
Cmya5	G	A	13: 93,095,787	T931I	possibly damaging	Het
Cntnap1	A	T	11: 101,177,425	I59F	possibly damaging	Het
Cop1	T	C	1: 159,239,597	M80T	probably damaging	Het
Cplx2	A	G	13: 54,379,647	S115G	possibly damaging	Het
Crtac1	A	G	19: 42,318,740	Y195H	probably damaging	Het
Csn1s2a	A	C	5: 87,781,838	S99R	possibly damaging	Het
Csn1s2b	T	A	5: 87,813,961	D41E	possibly damaging	Het
Cul9	C	T	17: 46,538,525	D565N	probably damaging	Het
Cux1	A	T	5: 136,311,556	N625K	possibly damaging	Het
Cyp2c37	A	T	19: 40,011,762	M443L	possibly damaging	Het
Cyp2s1	G	A	7: 25,809,285	T244I	possibly damaging	Het
Dgkh	C	T	14: 78,624,421	V135M	probably damaging	Het
Dtl	T	C	1: 191,546,565	E395G	possibly damaging	Het
Dyrk1a	G	T	16: 94,691,995	G658*	probably null	Het
Erlin2	T	C	8: 27,029,595	F117S	probably damaging	Het
Fkbp8	A	G	8: 70,531,523		probably null	Het
Fras1	T	C	5: 96,726,580	F2288S	possibly damaging	Het
Frmd3	A	G	4: 74,153,600	T240A	probably damaging	Het
H2-D1	A	G	17: 35,263,905	Y137C	probably damaging	Het
Helz2	A	G	2: 181,240,916	V28A	possibly damaging	Het
Hydin	A	G	8: 110,398,095	I579V	probably benign	Het
Il6	A	T	5: 30,013,493	Y29F	possibly damaging	Het
Ildr2	A	G	1: 166,307,840	D368G	probably damaging	Het
Junb	T	A	8: 84,978,159	I91F	probably damaging	Het
Kat2a	C	A	11: 100,712,203		probably benign	Het
Kat2a	A	T	11: 100,712,204		probably benign	Het
Kcnh5	T	A	12: 74,965,151	T665S	probably benign	Het
Kdm1b	A	T	13: 47,074,367	D608V	probably damaging	Het
Krcc1	A	G	6: 71,284,637	K218E	probably damaging	Het
Krt8	C	T	15: 101,996,951	V488M	probably benign	Het
Lzts1	C	T	8: 69,138,762	A245T	probably benign	Het
Mcm6	T	A	1: 128,359,486	Q27L	probably damaging	Het
Mfsd4b3	G	T	10: 39,947,690	Y191*	probably null	Het
Mgme1	T	C	2: 144,279,620	L332P	probably benign	Het
Mgme1	C	T	2: 144,276,404	Q199*	probably null	Het
Morc3	G	T	16: 93,860,587	E25*	probably null	Het
Mroh7	G	A	4: 106,690,987	A1098V	possibly damaging	Het
Mtrf1	G	A	14: 79,406,587	R174H	probably benign	Het
Mybpc3	G	A	2: 91,119,247	G45D	possibly damaging	Het
Mycbpap	A	T	11: 94,504,938	N733K	probably damaging	Het
N4bp1	T	C	8: 86,851,686	I684V	possibly damaging	Het
Nav2	A	T	7: 49,552,877	R1470*	probably null	Het
Ndufa9	A	T	6: 126,822,063	S364T	probably benign	Het
Nipal4	C	A	11: 46,162,010	A43S	possibly damaging	Het
Nlrp1a	T	A	11: 71,092,315	Y1275F	possibly damaging	Het
Nova1	A	T	12: 46,720,835	L8*	probably null	Het
Odam	G	T	5: 87,890,108	G181*	probably null	Het
Olfr1111	T	A	2: 87,150,659	M1L	possibly damaging	Het
Olfr1297	T	C	2: 111,621,534	D180G	probably damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Olfr186	A	T	16: 59,027,333	D191E	probably damaging	Het
Olfr283	T	C	15: 98,379,149		probably benign	Het
Olfr33	A	T	7: 102,713,495	I306N	probably damaging	Het
Olfr723	C	T	14: 49,928,897	V216I	probably benign	Het
Optn	T	A	2: 5,021,379	Q576L	probably benign	Het
Patl2	G	T	2: 122,128,848	S45*	probably null	Het
Pde2a	G	A	7: 101,502,933	G349E	probably benign	Het
Pdlim2	T	A	14: 70,168,015		probably benign	Het
Per1	T	C	11: 69,104,401	V653A	probably benign	Het
Phlda2	A	G	7: 143,502,268	S75P	probably damaging	Het
Poldip3	A	T	15: 83,137,505	M167K	possibly damaging	Het
Prpf38a	T	C	4: 108,579,081	I12V	probably benign	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Ptges3l	A	T	11: 101,424,622	M1K	probably null	Het
Rdh5	A	G	10: 128,913,784	Y296H	probably damaging	Het
Rnf2	T	A	1: 151,473,217	K51*	probably null	Het
Rpusd3	C	A	6: 113,416,848	R215L	probably benign	Het
Rsph4a	A	T	10: 33,909,240	E382D	probably damaging	Het
S1pr2	G	A	9: 20,968,449	Q28*	probably null	Het
Sesn1	A	T	10: 41,895,009	I179F	probably damaging	Het
Setd3	T	A	12: 108,113,371	E291V	probably benign	Het
Shc1	G	T	3: 89,426,996	R323L	probably damaging	Het
Slc22a5	T	C	11: 53,891,526	D5G	possibly damaging	Het
Slc6a19	T	C	13: 73,700,558	K26E	probably benign	Het
Slc9a3	A	G	13: 74,164,293	N670D	possibly damaging	Het
Spata19	A	T	9: 27,400,465	I127L	probably benign	Het
Speg	G	T	1: 75,427,703	V2751L	probably damaging	Het
Sptbn2	A	G	19: 4,729,309	D298G	probably benign	Het
Srm	T	C	4: 148,594,183	V289A	possibly damaging	Het
Stip1	C	T	19: 7,035,570	A49T	probably benign	Het
Tas2r118	C	A	6: 23,969,628	V145F	probably benign	Het
Tbc1d12	A	T	19: 38,865,725	K284*	probably null	Het
Tfcp2	T	C	15: 100,525,650	H125R	probably damaging	Het
Tfdp1	T	C	8: 13,373,073	V206A	probably damaging	Het
Tgtp2	A	G	11: 49,059,410	W112R	probably damaging	Het
Tmem71	T	G	15: 66,538,861	M221L	probably benign	Het
Tpcn1	T	C	5: 120,547,487	N436S	possibly damaging	Het
Usp4	C	T	9: 108,362,620	L183F	probably damaging	Het
Vmn2r55	A	T	7: 12,670,551	N308K	possibly damaging	Het
Zfp106	T	A	2: 120,533,919	D669V	probably damaging	Het
Zfp108	A	T	7: 24,260,148	I55L	probably benign	Het
Zfp512b	A	T	2: 181,586,338	S8R	probably damaging	Het
Zfp827	T	C	8: 79,061,281	S359P	probably benign	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTAACATCGATACTTCTGGCC -3'
(R):5'- CAGGTTCAGATCTTGTAAAAGTGAC -3'

Sequencing Primer
(F):5'- CGATACTTCTGGCCAAAAACTTG -3'
(R):5'- TTTTCTGCAGCACACTGG -3'

Posted On

2016-04-27