Incidental Mutation 'R0345:Ap2a2'
ID38392
Institutional Source Beutler Lab
Gene Symbol Ap2a2
Ensembl Gene ENSMUSG00000002957
Gene Nameadaptor-related protein complex 2, alpha 2 subunit
Synonymsalpha-C adaptin, alpha-adaptin C, 2410074K14Rik, Adtab, L25
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R0345 (G1)
Quality Score204
Status Validated
Chromosome7
Chromosomal Location141562173-141633011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141631293 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 914 (M914K)
Ref Sequence ENSEMBL: ENSMUSP00000003038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
PDB Structure
ALPHA-ADAPTIN APPENDAGE DOMAIN, FROM CLATHRIN ADAPTOR AP2 [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPSIN DPW PEPTIDE [X-RAY DIFFRACTION]
THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH AMPHIPHYSIN FXDXF [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPSIN DPW PEPTIDE [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ALPHA-ADAPTIN APPENDAGE DOMAIN, FROM THE AP2 ADAPTOR COMPLEX, BOUND TO 2 PEPTIDES FROM SYNAPTOJANIN170 [X-RAY DIFFRACTION]
AP2 CLATHRIN ADAPTOR CORE with Dileucine peptide RM(phosphoS)QIKRLLSE [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000003038
AA Change: M914K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957
AA Change: M914K

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 590 1.7e-147 PFAM
low complexity region 646 659 N/A INTRINSIC
low complexity region 661 684 N/A INTRINSIC
Alpha_adaptinC2 706 819 1.45e-26 SMART
Pfam:Alpha_adaptin_C 825 933 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062451
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190907
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Meta Mutation Damage Score 0.8115 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP-2 adaptor protein complex, which is involved in linking lipid and protein membrane components with the clathrin lattice. This interaction supports the formation of clathrin-coated vesicles, and the encoded subunit aids in the process by binding polyphosphoinositide-containing lipids in the cell membrane. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Ap2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Ap2a2 APN 7 141605019 splice site probably benign
IGL02664:Ap2a2 APN 7 141629223 missense probably benign 0.00
IGL02973:Ap2a2 APN 7 141631364 missense possibly damaging 0.63
IGL03366:Ap2a2 APN 7 141629273 missense probably benign
R2212:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R2904:Ap2a2 UTSW 7 141619478 missense probably damaging 0.98
R3412:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R3413:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R4962:Ap2a2 UTSW 7 141630148 missense probably damaging 1.00
R5602:Ap2a2 UTSW 7 141604942 missense probably benign
R5910:Ap2a2 UTSW 7 141598778 missense probably damaging 1.00
R6488:Ap2a2 UTSW 7 141602307 missense probably benign 0.02
R7003:Ap2a2 UTSW 7 141629196 missense probably benign
R7132:Ap2a2 UTSW 7 141619565 missense probably benign 0.32
R7140:Ap2a2 UTSW 7 141598864 missense probably benign 0.30
R7227:Ap2a2 UTSW 7 141620871 missense probably damaging 1.00
R7412:Ap2a2 UTSW 7 141626136 missense probably damaging 0.97
R7482:Ap2a2 UTSW 7 141602297 missense possibly damaging 0.46
R7632:Ap2a2 UTSW 7 141631323 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCTCCATGTATTCATGCCAGTG -3'
(R):5'- TGCAGCCCTTCTCAAACTGAGTCC -3'

Sequencing Primer
(F):5'- AGTGTGCATGCTGCAAAC -3'
(R):5'- CCGTGAATGGCAGTTTTCAGAC -3'
Posted On2013-05-23