Mutagenetix > Incidental Mutation

Incidental Mutation 'R4965:Cfap54'

383932

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R4965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 93066799 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 164 (I164F)

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020200] [ENSMUST00000168110] [ENSMUST00000168617] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020200
AA Change: I164F

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000020200
Gene: ENSMUSG00000020014
AA Change: I164F

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	643	3e-298	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168080

Predicted Effect

probably benign
Transcript: ENSMUST00000168110
AA Change: I164F

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: I164F

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168617

SMART Domains

Protein: ENSMUSP00000127905
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	148	4.3e-22	PFAM
Pfam:DUF4486	145	595	1.6e-244	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171781

Predicted Effect

probably benign
Transcript: ENSMUST00000212902
AA Change: I164F

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,069,672	T1541A	probably benign	Het
2810474O19Rik	G	T	6: 149,328,398	G981*	probably null	Het
4931423N10Rik	C	A	2: 23,245,115	T312K	probably benign	Het
9530002B09Rik	T	C	4: 122,700,492	M59T	probably benign	Het
Adam18	C	T	8: 24,641,811	C428Y	probably damaging	Het
Adcy5	A	G	16: 35,278,502	E700G	possibly damaging	Het
Adprh	G	T	16: 38,445,780	Y333*	probably null	Het
Agfg2	C	A	5: 137,667,177		probably null	Het
Akip1	A	T	7: 109,711,754	E167V	probably damaging	Het
Akr1c21	A	T	13: 4,580,305	Q199L	probably damaging	Het
Aldh9a1	C	A	1: 167,365,789	A455E	probably damaging	Het
Amph	G	A	13: 19,137,699	S520N	probably benign	Het
Ankrd52	A	G	10: 128,390,507	D1006G	probably benign	Het
Ap5z1	A	C	5: 142,467,676	Q133P	probably damaging	Het
Babam1	C	T	8: 71,404,388	A331V	possibly damaging	Het
Btc	T	C	5: 91,362,301		probably null	Het
Cacna2d3	A	G	14: 28,982,332	F831L	probably benign	Het
Cadm3	G	A	1: 173,337,097	P372L	probably damaging	Het
Capn5	A	T	7: 98,126,417	M439K	probably damaging	Het
Carf	T	C	1: 60,150,637	S639P	probably damaging	Het
Casp12	C	T	9: 5,352,250	R81C	probably benign	Het
Ces2e	G	T	8: 104,933,698	R555M	probably benign	Het
Cltc	C	T	11: 86,707,501	V1012I	probably damaging	Het
Cmya5	G	A	13: 93,095,787	T931I	possibly damaging	Het
Cntn6	A	G	6: 104,774,474	I364V	probably damaging	Het
Cntnap1	A	T	11: 101,177,425	I59F	possibly damaging	Het
Cop1	T	C	1: 159,239,597	M80T	probably damaging	Het
Cplx2	A	G	13: 54,379,647	S115G	possibly damaging	Het
Crtac1	A	G	19: 42,318,740	Y195H	probably damaging	Het
Csn1s2a	A	C	5: 87,781,838	S99R	possibly damaging	Het
Csn1s2b	T	A	5: 87,813,961	D41E	possibly damaging	Het
Cul9	C	T	17: 46,538,525	D565N	probably damaging	Het
Cux1	A	T	5: 136,311,556	N625K	possibly damaging	Het
Cyp2c37	A	T	19: 40,011,762	M443L	possibly damaging	Het
Cyp2s1	G	A	7: 25,809,285	T244I	possibly damaging	Het
Dgkh	C	T	14: 78,624,421	V135M	probably damaging	Het
Dtl	T	C	1: 191,546,565	E395G	possibly damaging	Het
Dyrk1a	G	T	16: 94,691,995	G658*	probably null	Het
Erlin2	T	C	8: 27,029,595	F117S	probably damaging	Het
Fkbp8	A	G	8: 70,531,523		probably null	Het
Fras1	T	C	5: 96,726,580	F2288S	possibly damaging	Het
Frmd3	A	G	4: 74,153,600	T240A	probably damaging	Het
H2-D1	A	G	17: 35,263,905	Y137C	probably damaging	Het
Helz2	A	G	2: 181,240,916	V28A	possibly damaging	Het
Hydin	A	G	8: 110,398,095	I579V	probably benign	Het
Il6	A	T	5: 30,013,493	Y29F	possibly damaging	Het
Ildr2	A	G	1: 166,307,840	D368G	probably damaging	Het
Junb	T	A	8: 84,978,159	I91F	probably damaging	Het
Kat2a	C	A	11: 100,712,203		probably benign	Het
Kat2a	A	T	11: 100,712,204		probably benign	Het
Kcnh5	T	A	12: 74,965,151	T665S	probably benign	Het
Kdm1b	A	T	13: 47,074,367	D608V	probably damaging	Het
Krcc1	A	G	6: 71,284,637	K218E	probably damaging	Het
Krt8	C	T	15: 101,996,951	V488M	probably benign	Het
Lzts1	C	T	8: 69,138,762	A245T	probably benign	Het
Mcm6	T	A	1: 128,359,486	Q27L	probably damaging	Het
Mfsd4b3	G	T	10: 39,947,690	Y191*	probably null	Het
Mgme1	C	T	2: 144,276,404	Q199*	probably null	Het
Mgme1	T	C	2: 144,279,620	L332P	probably benign	Het
Morc3	G	T	16: 93,860,587	E25*	probably null	Het
Mroh7	G	A	4: 106,690,987	A1098V	possibly damaging	Het
Mtrf1	G	A	14: 79,406,587	R174H	probably benign	Het
Mybpc3	G	A	2: 91,119,247	G45D	possibly damaging	Het
Mycbpap	A	T	11: 94,504,938	N733K	probably damaging	Het
N4bp1	T	C	8: 86,851,686	I684V	possibly damaging	Het
Nav2	A	T	7: 49,552,877	R1470*	probably null	Het
Ndufa9	A	T	6: 126,822,063	S364T	probably benign	Het
Nipal4	C	A	11: 46,162,010	A43S	possibly damaging	Het
Nlrp1a	T	A	11: 71,092,315	Y1275F	possibly damaging	Het
Nova1	A	T	12: 46,720,835	L8*	probably null	Het
Odam	G	T	5: 87,890,108	G181*	probably null	Het
Olfr1111	T	A	2: 87,150,659	M1L	possibly damaging	Het
Olfr1297	T	C	2: 111,621,534	D180G	probably damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Olfr186	A	T	16: 59,027,333	D191E	probably damaging	Het
Olfr283	T	C	15: 98,379,149		probably benign	Het
Olfr33	A	T	7: 102,713,495	I306N	probably damaging	Het
Olfr723	C	T	14: 49,928,897	V216I	probably benign	Het
Optn	T	A	2: 5,021,379	Q576L	probably benign	Het
Patl2	G	T	2: 122,128,848	S45*	probably null	Het
Pde2a	G	A	7: 101,502,933	G349E	probably benign	Het
Pdlim2	T	A	14: 70,168,015		probably benign	Het
Per1	T	C	11: 69,104,401	V653A	probably benign	Het
Phlda2	A	G	7: 143,502,268	S75P	probably damaging	Het
Poldip3	A	T	15: 83,137,505	M167K	possibly damaging	Het
Prpf38a	T	C	4: 108,579,081	I12V	probably benign	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Ptges3l	A	T	11: 101,424,622	M1K	probably null	Het
Rdh5	A	G	10: 128,913,784	Y296H	probably damaging	Het
Rnf2	T	A	1: 151,473,217	K51*	probably null	Het
Rpusd3	C	A	6: 113,416,848	R215L	probably benign	Het
Rsph4a	A	T	10: 33,909,240	E382D	probably damaging	Het
S1pr2	G	A	9: 20,968,449	Q28*	probably null	Het
Sesn1	A	T	10: 41,895,009	I179F	probably damaging	Het
Setd3	T	A	12: 108,113,371	E291V	probably benign	Het
Shc1	G	T	3: 89,426,996	R323L	probably damaging	Het
Slc22a5	T	C	11: 53,891,526	D5G	possibly damaging	Het
Slc6a19	T	C	13: 73,700,558	K26E	probably benign	Het
Slc9a3	A	G	13: 74,164,293	N670D	possibly damaging	Het
Spata19	A	T	9: 27,400,465	I127L	probably benign	Het
Speg	G	T	1: 75,427,703	V2751L	probably damaging	Het
Sptbn2	A	G	19: 4,729,309	D298G	probably benign	Het
Srm	T	C	4: 148,594,183	V289A	possibly damaging	Het
Stip1	C	T	19: 7,035,570	A49T	probably benign	Het
Tas2r118	C	A	6: 23,969,628	V145F	probably benign	Het
Tbc1d12	A	T	19: 38,865,725	K284*	probably null	Het
Tfcp2	T	C	15: 100,525,650	H125R	probably damaging	Het
Tfdp1	T	C	8: 13,373,073	V206A	probably damaging	Het
Tgtp2	A	G	11: 49,059,410	W112R	probably damaging	Het
Tmem71	T	G	15: 66,538,861	M221L	probably benign	Het
Tpcn1	T	C	5: 120,547,487	N436S	possibly damaging	Het
Usp4	C	T	9: 108,362,620	L183F	probably damaging	Het
Vmn2r55	A	T	7: 12,670,551	N308K	possibly damaging	Het
Zfp106	T	A	2: 120,533,919	D669V	probably damaging	Het
Zfp108	A	T	7: 24,260,148	I55L	probably benign	Het
Zfp512b	A	T	2: 181,586,338	S8R	probably damaging	Het
Zfp827	T	C	8: 79,061,281	S359P	probably benign	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTGCCAGACGCCTTATTAG -3'
(R):5'- AGAAGTTACCTTGAATCACTGGC -3'

Sequencing Primer
(F):5'- AGGAAGCACTCTAGTCCCTGTTG -3'
(R):5'- GAATCACTGGCTGCATTTGTC -3'

Posted On

2016-04-27