Incidental Mutation 'R4965:Nlrp1a'
ID383939
Institutional Source Beutler Lab
Gene Symbol Nlrp1a
Ensembl Gene ENSMUSG00000069830
Gene NameNLR family, pyrin domain containing 1A
SynonymsNalp1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R4965 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location71092236-71144704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71092315 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1275 (Y1275F)
Ref Sequence ENSEMBL: ENSMUSP00000038186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048514] [ENSMUST00000108518]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048514
AA Change: Y1275F

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038186
Gene: ENSMUSG00000069830
AA Change: Y1275F

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 4.6e-41 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 742 769 3.04e-5 SMART
low complexity region 856 870 N/A INTRINSIC
Pfam:FIIND 921 1173 1.6e-102 PFAM
Pfam:CARD 1209 1292 2.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108518
AA Change: Y1157F

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104158
Gene: ENSMUSG00000069830
AA Change: Y1157F

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 1.1e-40 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 661 688 2.85e1 SMART
LRR 689 716 3.04e-5 SMART
Pfam:FIIND 819 1073 3e-136 PFAM
Pfam:CARD 1091 1174 8.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for an ENU-induced allele develop a multi-organ neutrophilic inflammatory disease. Homozygotes for the same ENU-induced allele develop a similar but lethal condition and exhibit neutrophilia, lymphopenia, splenomegaly, loss of peritoneal macrophages, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,672 T1541A probably benign Het
2810474O19Rik G T 6: 149,328,398 G981* probably null Het
4931423N10Rik C A 2: 23,245,115 T312K probably benign Het
9530002B09Rik T C 4: 122,700,492 M59T probably benign Het
Adam18 C T 8: 24,641,811 C428Y probably damaging Het
Adcy5 A G 16: 35,278,502 E700G possibly damaging Het
Adprh G T 16: 38,445,780 Y333* probably null Het
Agfg2 C A 5: 137,667,177 probably null Het
Akip1 A T 7: 109,711,754 E167V probably damaging Het
Akr1c21 A T 13: 4,580,305 Q199L probably damaging Het
Aldh9a1 C A 1: 167,365,789 A455E probably damaging Het
Amph G A 13: 19,137,699 S520N probably benign Het
Ankrd52 A G 10: 128,390,507 D1006G probably benign Het
Ap5z1 A C 5: 142,467,676 Q133P probably damaging Het
Babam1 C T 8: 71,404,388 A331V possibly damaging Het
Btc T C 5: 91,362,301 probably null Het
Cacna2d3 A G 14: 28,982,332 F831L probably benign Het
Cadm3 G A 1: 173,337,097 P372L probably damaging Het
Capn5 A T 7: 98,126,417 M439K probably damaging Het
Carf T C 1: 60,150,637 S639P probably damaging Het
Casp12 C T 9: 5,352,250 R81C probably benign Het
Ces2e G T 8: 104,933,698 R555M probably benign Het
Cfap54 T A 10: 93,066,799 I164F probably benign Het
Cltc C T 11: 86,707,501 V1012I probably damaging Het
Cmya5 G A 13: 93,095,787 T931I possibly damaging Het
Cntn6 A G 6: 104,774,474 I364V probably damaging Het
Cntnap1 A T 11: 101,177,425 I59F possibly damaging Het
Cop1 T C 1: 159,239,597 M80T probably damaging Het
Cplx2 A G 13: 54,379,647 S115G possibly damaging Het
Crtac1 A G 19: 42,318,740 Y195H probably damaging Het
Csn1s2a A C 5: 87,781,838 S99R possibly damaging Het
Csn1s2b T A 5: 87,813,961 D41E possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cux1 A T 5: 136,311,556 N625K possibly damaging Het
Cyp2c37 A T 19: 40,011,762 M443L possibly damaging Het
Cyp2s1 G A 7: 25,809,285 T244I possibly damaging Het
Dgkh C T 14: 78,624,421 V135M probably damaging Het
Dtl T C 1: 191,546,565 E395G possibly damaging Het
Dyrk1a G T 16: 94,691,995 G658* probably null Het
Erlin2 T C 8: 27,029,595 F117S probably damaging Het
Fkbp8 A G 8: 70,531,523 probably null Het
Fras1 T C 5: 96,726,580 F2288S possibly damaging Het
Frmd3 A G 4: 74,153,600 T240A probably damaging Het
H2-D1 A G 17: 35,263,905 Y137C probably damaging Het
Helz2 A G 2: 181,240,916 V28A possibly damaging Het
Hydin A G 8: 110,398,095 I579V probably benign Het
Il6 A T 5: 30,013,493 Y29F possibly damaging Het
Ildr2 A G 1: 166,307,840 D368G probably damaging Het
Junb T A 8: 84,978,159 I91F probably damaging Het
Kat2a C A 11: 100,712,203 probably benign Het
Kat2a A T 11: 100,712,204 probably benign Het
Kcnh5 T A 12: 74,965,151 T665S probably benign Het
Kdm1b A T 13: 47,074,367 D608V probably damaging Het
Krcc1 A G 6: 71,284,637 K218E probably damaging Het
Krt8 C T 15: 101,996,951 V488M probably benign Het
Lzts1 C T 8: 69,138,762 A245T probably benign Het
Mcm6 T A 1: 128,359,486 Q27L probably damaging Het
Mfsd4b3 G T 10: 39,947,690 Y191* probably null Het
Mgme1 C T 2: 144,276,404 Q199* probably null Het
Mgme1 T C 2: 144,279,620 L332P probably benign Het
Morc3 G T 16: 93,860,587 E25* probably null Het
Mroh7 G A 4: 106,690,987 A1098V possibly damaging Het
Mtrf1 G A 14: 79,406,587 R174H probably benign Het
Mybpc3 G A 2: 91,119,247 G45D possibly damaging Het
Mycbpap A T 11: 94,504,938 N733K probably damaging Het
N4bp1 T C 8: 86,851,686 I684V possibly damaging Het
Nav2 A T 7: 49,552,877 R1470* probably null Het
Ndufa9 A T 6: 126,822,063 S364T probably benign Het
Nipal4 C A 11: 46,162,010 A43S possibly damaging Het
Nova1 A T 12: 46,720,835 L8* probably null Het
Odam G T 5: 87,890,108 G181* probably null Het
Olfr1111 T A 2: 87,150,659 M1L possibly damaging Het
Olfr1297 T C 2: 111,621,534 D180G probably damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Olfr186 A T 16: 59,027,333 D191E probably damaging Het
Olfr283 T C 15: 98,379,149 probably benign Het
Olfr33 A T 7: 102,713,495 I306N probably damaging Het
Olfr723 C T 14: 49,928,897 V216I probably benign Het
Optn T A 2: 5,021,379 Q576L probably benign Het
Patl2 G T 2: 122,128,848 S45* probably null Het
Pde2a G A 7: 101,502,933 G349E probably benign Het
Pdlim2 T A 14: 70,168,015 probably benign Het
Per1 T C 11: 69,104,401 V653A probably benign Het
Phlda2 A G 7: 143,502,268 S75P probably damaging Het
Poldip3 A T 15: 83,137,505 M167K possibly damaging Het
Prpf38a T C 4: 108,579,081 I12V probably benign Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Ptges3l A T 11: 101,424,622 M1K probably null Het
Rdh5 A G 10: 128,913,784 Y296H probably damaging Het
Rnf2 T A 1: 151,473,217 K51* probably null Het
Rpusd3 C A 6: 113,416,848 R215L probably benign Het
Rsph4a A T 10: 33,909,240 E382D probably damaging Het
S1pr2 G A 9: 20,968,449 Q28* probably null Het
Sesn1 A T 10: 41,895,009 I179F probably damaging Het
Setd3 T A 12: 108,113,371 E291V probably benign Het
Shc1 G T 3: 89,426,996 R323L probably damaging Het
Slc22a5 T C 11: 53,891,526 D5G possibly damaging Het
Slc6a19 T C 13: 73,700,558 K26E probably benign Het
Slc9a3 A G 13: 74,164,293 N670D possibly damaging Het
Spata19 A T 9: 27,400,465 I127L probably benign Het
Speg G T 1: 75,427,703 V2751L probably damaging Het
Sptbn2 A G 19: 4,729,309 D298G probably benign Het
Srm T C 4: 148,594,183 V289A possibly damaging Het
Stip1 C T 19: 7,035,570 A49T probably benign Het
Tas2r118 C A 6: 23,969,628 V145F probably benign Het
Tbc1d12 A T 19: 38,865,725 K284* probably null Het
Tfcp2 T C 15: 100,525,650 H125R probably damaging Het
Tfdp1 T C 8: 13,373,073 V206A probably damaging Het
Tgtp2 A G 11: 49,059,410 W112R probably damaging Het
Tmem71 T G 15: 66,538,861 M221L probably benign Het
Tpcn1 T C 5: 120,547,487 N436S possibly damaging Het
Usp4 C T 9: 108,362,620 L183F probably damaging Het
Vmn2r55 A T 7: 12,670,551 N308K possibly damaging Het
Zfp106 T A 2: 120,533,919 D669V probably damaging Het
Zfp108 A T 7: 24,260,148 I55L probably benign Het
Zfp512b A T 2: 181,586,338 S8R probably damaging Het
Zfp827 T C 8: 79,061,281 S359P probably benign Het
Other mutations in Nlrp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Nlrp1a APN 11 71092957 missense probably benign 0.00
IGL00771:Nlrp1a APN 11 71122741 nonsense probably null
IGL01408:Nlrp1a APN 11 71122916 missense probably benign 0.04
IGL01886:Nlrp1a APN 11 71123501 missense probably benign
IGL02221:Nlrp1a APN 11 71123118 missense possibly damaging 0.88
IGL02291:Nlrp1a APN 11 71122589 critical splice donor site probably null
IGL02375:Nlrp1a APN 11 71113513 nonsense probably null
IGL02408:Nlrp1a APN 11 71122630 missense probably benign 0.00
IGL02516:Nlrp1a APN 11 71114460 missense probably damaging 1.00
IGL02583:Nlrp1a APN 11 71123401 missense probably benign 0.03
IGL02622:Nlrp1a APN 11 71123000 missense possibly damaging 0.88
IGL02642:Nlrp1a APN 11 71123532 missense probably benign 0.12
IGL02823:Nlrp1a APN 11 71092423 missense probably damaging 0.96
IGL02859:Nlrp1a APN 11 71106086 missense possibly damaging 0.57
IGL02997:Nlrp1a APN 11 71123665 missense probably damaging 1.00
IGL03342:Nlrp1a APN 11 71122791 missense probably benign 0.19
Ants UTSW 11 71142338 missense probably benign 0.01
dreary UTSW 11 71113640 critical splice acceptor site probably null
picnic UTSW 11 71122747 missense possibly damaging 0.87
seedless UTSW 11 71123552 missense probably benign 0.44
watermelon UTSW 11 71122705 missense probably benign 0.08
R0022:Nlrp1a UTSW 11 71123381 missense probably damaging 0.99
R0345:Nlrp1a UTSW 11 71123675 missense probably damaging 1.00
R0360:Nlrp1a UTSW 11 71114004 intron probably benign
R0364:Nlrp1a UTSW 11 71114004 intron probably benign
R0566:Nlrp1a UTSW 11 71122942 missense probably benign 0.00
R1177:Nlrp1a UTSW 11 71107721 missense probably damaging 1.00
R1240:Nlrp1a UTSW 11 71113466 critical splice donor site probably null
R1263:Nlrp1a UTSW 11 71097122 missense probably benign 0.01
R1681:Nlrp1a UTSW 11 71142358 missense unknown
R1743:Nlrp1a UTSW 11 71124206 missense probably benign 0.04
R1826:Nlrp1a UTSW 11 71107980 intron probably benign
R1826:Nlrp1a UTSW 11 71122747 missense possibly damaging 0.87
R1981:Nlrp1a UTSW 11 71098938 missense probably damaging 1.00
R2083:Nlrp1a UTSW 11 71124220 missense possibly damaging 0.59
R2116:Nlrp1a UTSW 11 71114500 nonsense probably null
R2134:Nlrp1a UTSW 11 71124188 missense probably benign 0.00
R2148:Nlrp1a UTSW 11 71122907 nonsense probably null
R2301:Nlrp1a UTSW 11 71106101 missense possibly damaging 0.94
R3029:Nlrp1a UTSW 11 71123630 missense probably damaging 1.00
R3113:Nlrp1a UTSW 11 71123665 missense probably damaging 1.00
R3801:Nlrp1a UTSW 11 71122703 missense probably benign 0.08
R3898:Nlrp1a UTSW 11 71122874 missense probably benign 0.00
R4254:Nlrp1a UTSW 11 71123028 nonsense probably null
R4397:Nlrp1a UTSW 11 71097204 missense probably benign 0.00
R4647:Nlrp1a UTSW 11 71097126 splice site probably null
R4740:Nlrp1a UTSW 11 71113640 critical splice acceptor site probably null
R5009:Nlrp1a UTSW 11 71122705 missense probably benign 0.08
R5103:Nlrp1a UTSW 11 71099526 missense probably damaging 0.99
R5355:Nlrp1a UTSW 11 71124251 missense probably benign 0.00
R5577:Nlrp1a UTSW 11 71099574 missense probably damaging 1.00
R5892:Nlrp1a UTSW 11 71099645 missense probably damaging 1.00
R5949:Nlrp1a UTSW 11 71098989 missense probably damaging 1.00
R5964:Nlrp1a UTSW 11 71123020 missense probably benign 0.00
R6220:Nlrp1a UTSW 11 71142338 missense probably benign 0.01
R6564:Nlrp1a UTSW 11 71123572 missense probably damaging 1.00
R6586:Nlrp1a UTSW 11 71106073 missense probably benign 0.00
R6925:Nlrp1a UTSW 11 71092513 missense probably null 0.99
R7013:Nlrp1a UTSW 11 71123552 missense probably benign 0.44
R7155:Nlrp1a UTSW 11 71124079 missense possibly damaging 0.93
R7214:Nlrp1a UTSW 11 71123293 missense probably damaging 1.00
R7268:Nlrp1a UTSW 11 71124242 missense probably benign 0.00
R7388:Nlrp1a UTSW 11 71123197 missense probably damaging 1.00
R7404:Nlrp1a UTSW 11 71097093 nonsense probably null
R7409:Nlrp1a UTSW 11 71122808 missense probably benign 0.03
R7410:Nlrp1a UTSW 11 71123857 missense probably damaging 0.99
R7440:Nlrp1a UTSW 11 71092324 missense probably damaging 0.99
R7447:Nlrp1a UTSW 11 71092411 missense probably damaging 1.00
R7450:Nlrp1a UTSW 11 71107658 missense probably damaging 1.00
R7569:Nlrp1a UTSW 11 71109043 missense probably benign 0.00
R7600:Nlrp1a UTSW 11 71098914 missense probably damaging 0.96
R7634:Nlrp1a UTSW 11 71099528 missense probably benign 0.19
R7734:Nlrp1a UTSW 11 71108000 missense unknown
R7747:Nlrp1a UTSW 11 71123408 missense possibly damaging 0.85
X0026:Nlrp1a UTSW 11 71142316 missense probably benign 0.18
Z1177:Nlrp1a UTSW 11 71123169 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCATGGAAGCACTGCCACAAG -3'
(R):5'- GCACTTCATGGACCAGCATC -3'

Sequencing Primer
(F):5'- ACTCAGATGGCCATTGGTTACAG -3'
(R):5'- TTCATGGACCAGCATCGGGAG -3'
Posted On2016-04-27