Mutagenetix > Incidental Mutation

Incidental Mutation 'R4965:Cmya5'

383955

Institutional Source

Beutler Lab

Gene Symbol

Cmya5

Ensembl Gene

ENSMUSG00000047419

Gene Name

cardiomyopathy associated 5

Synonyms

Myospryn, 2310076E21Rik, 2310076E16Rik

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.252) question?

Stock #

R4965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93040713-93144724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 93095787 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 931 (T931I)

Ref Sequence

ENSEMBL: ENSMUSP00000050408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062122]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062122
AA Change: T931I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: T931I

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
low complexity region	129	140	N/A	INTRINSIC
internal_repeat_1	448	535	5.09e-18	PROSPERO
internal_repeat_1	543	625	5.09e-18	PROSPERO
low complexity region	626	645	N/A	INTRINSIC
low complexity region	679	691	N/A	INTRINSIC
low complexity region	734	741	N/A	INTRINSIC
low complexity region	1001	1010	N/A	INTRINSIC
low complexity region	1166	1183	N/A	INTRINSIC
low complexity region	1259	1267	N/A	INTRINSIC
low complexity region	1440	1449	N/A	INTRINSIC
low complexity region	1876	1889	N/A	INTRINSIC
low complexity region	2632	2645	N/A	INTRINSIC
low complexity region	3048	3057	N/A	INTRINSIC
FN3	3312	3399	7.29e-4	SMART
FN3	3411	3492	1.3e0	SMART
Pfam:SPRY	3551	3668	6.7e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224009

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,069,672	T1541A	probably benign	Het
2810474O19Rik	G	T	6: 149,328,398	G981*	probably null	Het
4931423N10Rik	C	A	2: 23,245,115	T312K	probably benign	Het
9530002B09Rik	T	C	4: 122,700,492	M59T	probably benign	Het
Adam18	C	T	8: 24,641,811	C428Y	probably damaging	Het
Adcy5	A	G	16: 35,278,502	E700G	possibly damaging	Het
Adprh	G	T	16: 38,445,780	Y333*	probably null	Het
Agfg2	C	A	5: 137,667,177		probably null	Het
Akip1	A	T	7: 109,711,754	E167V	probably damaging	Het
Akr1c21	A	T	13: 4,580,305	Q199L	probably damaging	Het
Aldh9a1	C	A	1: 167,365,789	A455E	probably damaging	Het
Amph	G	A	13: 19,137,699	S520N	probably benign	Het
Ankrd52	A	G	10: 128,390,507	D1006G	probably benign	Het
Ap5z1	A	C	5: 142,467,676	Q133P	probably damaging	Het
Babam1	C	T	8: 71,404,388	A331V	possibly damaging	Het
Btc	T	C	5: 91,362,301		probably null	Het
Cacna2d3	A	G	14: 28,982,332	F831L	probably benign	Het
Cadm3	G	A	1: 173,337,097	P372L	probably damaging	Het
Capn5	A	T	7: 98,126,417	M439K	probably damaging	Het
Carf	T	C	1: 60,150,637	S639P	probably damaging	Het
Casp12	C	T	9: 5,352,250	R81C	probably benign	Het
Ces2e	G	T	8: 104,933,698	R555M	probably benign	Het
Cfap54	T	A	10: 93,066,799	I164F	probably benign	Het
Cltc	C	T	11: 86,707,501	V1012I	probably damaging	Het
Cntn6	A	G	6: 104,774,474	I364V	probably damaging	Het
Cntnap1	A	T	11: 101,177,425	I59F	possibly damaging	Het
Cop1	T	C	1: 159,239,597	M80T	probably damaging	Het
Cplx2	A	G	13: 54,379,647	S115G	possibly damaging	Het
Crtac1	A	G	19: 42,318,740	Y195H	probably damaging	Het
Csn1s2a	A	C	5: 87,781,838	S99R	possibly damaging	Het
Csn1s2b	T	A	5: 87,813,961	D41E	possibly damaging	Het
Cul9	C	T	17: 46,538,525	D565N	probably damaging	Het
Cux1	A	T	5: 136,311,556	N625K	possibly damaging	Het
Cyp2c37	A	T	19: 40,011,762	M443L	possibly damaging	Het
Cyp2s1	G	A	7: 25,809,285	T244I	possibly damaging	Het
Dgkh	C	T	14: 78,624,421	V135M	probably damaging	Het
Dtl	T	C	1: 191,546,565	E395G	possibly damaging	Het
Dyrk1a	G	T	16: 94,691,995	G658*	probably null	Het
Erlin2	T	C	8: 27,029,595	F117S	probably damaging	Het
Fkbp8	A	G	8: 70,531,523		probably null	Het
Fras1	T	C	5: 96,726,580	F2288S	possibly damaging	Het
Frmd3	A	G	4: 74,153,600	T240A	probably damaging	Het
H2-D1	A	G	17: 35,263,905	Y137C	probably damaging	Het
Helz2	A	G	2: 181,240,916	V28A	possibly damaging	Het
Hydin	A	G	8: 110,398,095	I579V	probably benign	Het
Il6	A	T	5: 30,013,493	Y29F	possibly damaging	Het
Ildr2	A	G	1: 166,307,840	D368G	probably damaging	Het
Junb	T	A	8: 84,978,159	I91F	probably damaging	Het
Kat2a	C	A	11: 100,712,203		probably benign	Het
Kat2a	A	T	11: 100,712,204		probably benign	Het
Kcnh5	T	A	12: 74,965,151	T665S	probably benign	Het
Kdm1b	A	T	13: 47,074,367	D608V	probably damaging	Het
Krcc1	A	G	6: 71,284,637	K218E	probably damaging	Het
Krt8	C	T	15: 101,996,951	V488M	probably benign	Het
Lzts1	C	T	8: 69,138,762	A245T	probably benign	Het
Mcm6	T	A	1: 128,359,486	Q27L	probably damaging	Het
Mfsd4b3	G	T	10: 39,947,690	Y191*	probably null	Het
Mgme1	T	C	2: 144,279,620	L332P	probably benign	Het
Mgme1	C	T	2: 144,276,404	Q199*	probably null	Het
Morc3	G	T	16: 93,860,587	E25*	probably null	Het
Mroh7	G	A	4: 106,690,987	A1098V	possibly damaging	Het
Mtrf1	G	A	14: 79,406,587	R174H	probably benign	Het
Mybpc3	G	A	2: 91,119,247	G45D	possibly damaging	Het
Mycbpap	A	T	11: 94,504,938	N733K	probably damaging	Het
N4bp1	T	C	8: 86,851,686	I684V	possibly damaging	Het
Nav2	A	T	7: 49,552,877	R1470*	probably null	Het
Ndufa9	A	T	6: 126,822,063	S364T	probably benign	Het
Nipal4	C	A	11: 46,162,010	A43S	possibly damaging	Het
Nlrp1a	T	A	11: 71,092,315	Y1275F	possibly damaging	Het
Nova1	A	T	12: 46,720,835	L8*	probably null	Het
Odam	G	T	5: 87,890,108	G181*	probably null	Het
Olfr1111	T	A	2: 87,150,659	M1L	possibly damaging	Het
Olfr1297	T	C	2: 111,621,534	D180G	probably damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Olfr186	A	T	16: 59,027,333	D191E	probably damaging	Het
Olfr283	T	C	15: 98,379,149		probably benign	Het
Olfr33	A	T	7: 102,713,495	I306N	probably damaging	Het
Olfr723	C	T	14: 49,928,897	V216I	probably benign	Het
Optn	T	A	2: 5,021,379	Q576L	probably benign	Het
Patl2	G	T	2: 122,128,848	S45*	probably null	Het
Pde2a	G	A	7: 101,502,933	G349E	probably benign	Het
Pdlim2	T	A	14: 70,168,015		probably benign	Het
Per1	T	C	11: 69,104,401	V653A	probably benign	Het
Phlda2	A	G	7: 143,502,268	S75P	probably damaging	Het
Poldip3	A	T	15: 83,137,505	M167K	possibly damaging	Het
Prpf38a	T	C	4: 108,579,081	I12V	probably benign	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Ptges3l	A	T	11: 101,424,622	M1K	probably null	Het
Rdh5	A	G	10: 128,913,784	Y296H	probably damaging	Het
Rnf2	T	A	1: 151,473,217	K51*	probably null	Het
Rpusd3	C	A	6: 113,416,848	R215L	probably benign	Het
Rsph4a	A	T	10: 33,909,240	E382D	probably damaging	Het
S1pr2	G	A	9: 20,968,449	Q28*	probably null	Het
Sesn1	A	T	10: 41,895,009	I179F	probably damaging	Het
Setd3	T	A	12: 108,113,371	E291V	probably benign	Het
Shc1	G	T	3: 89,426,996	R323L	probably damaging	Het
Slc22a5	T	C	11: 53,891,526	D5G	possibly damaging	Het
Slc6a19	T	C	13: 73,700,558	K26E	probably benign	Het
Slc9a3	A	G	13: 74,164,293	N670D	possibly damaging	Het
Spata19	A	T	9: 27,400,465	I127L	probably benign	Het
Speg	G	T	1: 75,427,703	V2751L	probably damaging	Het
Sptbn2	A	G	19: 4,729,309	D298G	probably benign	Het
Srm	T	C	4: 148,594,183	V289A	possibly damaging	Het
Stip1	C	T	19: 7,035,570	A49T	probably benign	Het
Tas2r118	C	A	6: 23,969,628	V145F	probably benign	Het
Tbc1d12	A	T	19: 38,865,725	K284*	probably null	Het
Tfcp2	T	C	15: 100,525,650	H125R	probably damaging	Het
Tfdp1	T	C	8: 13,373,073	V206A	probably damaging	Het
Tgtp2	A	G	11: 49,059,410	W112R	probably damaging	Het
Tmem71	T	G	15: 66,538,861	M221L	probably benign	Het
Tpcn1	T	C	5: 120,547,487	N436S	possibly damaging	Het
Usp4	C	T	9: 108,362,620	L183F	probably damaging	Het
Vmn2r55	A	T	7: 12,670,551	N308K	possibly damaging	Het
Zfp106	T	A	2: 120,533,919	D669V	probably damaging	Het
Zfp108	A	T	7: 24,260,148	I55L	probably benign	Het
Zfp512b	A	T	2: 181,586,338	S8R	probably damaging	Het
Zfp827	T	C	8: 79,061,281	S359P	probably benign	Het

Other mutations in Cmya5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Cmya5	APN	13	93093120	missense	probably benign	0.13
IGL00516:Cmya5	APN	13	93098167	missense	possibly damaging	0.73
IGL00654:Cmya5	APN	13	93094161	missense	probably benign	0.00
IGL00948:Cmya5	APN	13	93091036	missense	probably benign
IGL00966:Cmya5	APN	13	93097906	missense	probably benign	0.33
IGL00988:Cmya5	APN	13	93097933	missense	possibly damaging	0.96
IGL01106:Cmya5	APN	13	93084612	missense	probably damaging	1.00
IGL01331:Cmya5	APN	13	93096946	missense	possibly damaging	0.53
IGL01392:Cmya5	APN	13	93089206	missense	probably damaging	0.99
IGL01508:Cmya5	APN	13	93094027	missense	probably benign
IGL01679:Cmya5	APN	13	93065320	missense	probably damaging	1.00
IGL01749:Cmya5	APN	13	93089299	missense	probably benign	0.00
IGL01861:Cmya5	APN	13	93089748	missense	probably damaging	1.00
IGL02021:Cmya5	APN	13	93094549	missense	probably benign	0.00
IGL02034:Cmya5	APN	13	93084535	splice site	probably benign
IGL02103:Cmya5	APN	13	93092127	missense	probably benign	0.05
IGL02174:Cmya5	APN	13	93048907	missense	possibly damaging	0.76
IGL02176:Cmya5	APN	13	93090150	missense	probably damaging	1.00
IGL02210:Cmya5	APN	13	93092734	missense	probably benign	0.14
IGL02229:Cmya5	APN	13	93092686	missense	possibly damaging	0.54
IGL02306:Cmya5	APN	13	93098019	missense	probably damaging	1.00
IGL02311:Cmya5	APN	13	93090655	missense	probably benign	0.40
IGL02409:Cmya5	APN	13	93090198	missense	probably damaging	0.96
IGL02561:Cmya5	APN	13	93091858	missense	probably benign	0.00
IGL02676:Cmya5	APN	13	93092853	missense	probably damaging	1.00
IGL02683:Cmya5	APN	13	93090997	nonsense	probably null
IGL02685:Cmya5	APN	13	93090997	nonsense	probably null
IGL02686:Cmya5	APN	13	93090997	nonsense	probably null
IGL02724:Cmya5	APN	13	93096655	missense	probably benign
IGL02727:Cmya5	APN	13	93098245	missense	possibly damaging	0.73
IGL02965:Cmya5	APN	13	93092557	missense	probably benign	0.41
IGL03079:Cmya5	APN	13	93097701	missense	possibly damaging	0.85
IGL03144:Cmya5	APN	13	93090868	missense	probably damaging	1.00
IGL03253:Cmya5	APN	13	93091270	nonsense	probably null
IGL03336:Cmya5	APN	13	93093505	missense	possibly damaging	0.84
IGL03138:Cmya5	UTSW	13	93065342	missense	probably damaging	1.00
P0023:Cmya5	UTSW	13	93089346	missense	probably benign	0.22
P4748:Cmya5	UTSW	13	93074475	splice site	probably benign
R0123:Cmya5	UTSW	13	93095904	missense	possibly damaging	0.84
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0331:Cmya5	UTSW	13	93144403	missense	possibly damaging	0.53
R0363:Cmya5	UTSW	13	93094869	missense	possibly damaging	0.77
R0382:Cmya5	UTSW	13	93092748	missense	probably benign	0.06
R0416:Cmya5	UTSW	13	93089856	missense	probably benign	0.05
R0446:Cmya5	UTSW	13	93093656	missense	probably benign
R0457:Cmya5	UTSW	13	93095587	missense	possibly damaging	0.84
R0673:Cmya5	UTSW	13	93089997	missense	probably damaging	1.00
R0674:Cmya5	UTSW	13	93092791	missense	probably damaging	1.00
R0692:Cmya5	UTSW	13	93093849	nonsense	probably null
R0698:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R1227:Cmya5	UTSW	13	93094446	missense	probably damaging	0.99
R1272:Cmya5	UTSW	13	93095112	missense	possibly damaging	0.79
R1335:Cmya5	UTSW	13	93041535	missense	possibly damaging	0.65
R1353:Cmya5	UTSW	13	93041525	missense	probably damaging	1.00
R1354:Cmya5	UTSW	13	93092058	missense	possibly damaging	0.46
R1458:Cmya5	UTSW	13	93065327	missense	probably benign	0.44
R1572:Cmya5	UTSW	13	93094269	missense	possibly damaging	0.61
R1698:Cmya5	UTSW	13	93063519	missense	probably benign	0.27
R1735:Cmya5	UTSW	13	93089789	missense	probably benign	0.11
R1743:Cmya5	UTSW	13	93097317	missense	probably benign	0.33
R1750:Cmya5	UTSW	13	93095663	missense	probably benign
R1827:Cmya5	UTSW	13	93074448	missense	possibly damaging	0.80
R2068:Cmya5	UTSW	13	93090524	missense	possibly damaging	0.93
R2088:Cmya5	UTSW	13	93092812	missense	probably damaging	1.00
R2132:Cmya5	UTSW	13	93069383	missense	probably damaging	1.00
R2216:Cmya5	UTSW	13	93093495	missense	probably damaging	1.00
R2363:Cmya5	UTSW	13	93093702	missense	probably benign	0.15
R2497:Cmya5	UTSW	13	93098005	missense	possibly damaging	0.53
R2509:Cmya5	UTSW	13	93093558	missense	probably benign	0.41
R2917:Cmya5	UTSW	13	93091064	nonsense	probably null
R2944:Cmya5	UTSW	13	93092842	nonsense	probably null
R3039:Cmya5	UTSW	13	93092250	missense	probably benign	0.12
R3078:Cmya5	UTSW	13	93048927	missense	probably damaging	0.99
R3708:Cmya5	UTSW	13	93095366	nonsense	probably null
R3717:Cmya5	UTSW	13	93092487	missense	probably benign	0.12
R3768:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3769:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3840:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3841:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3882:Cmya5	UTSW	13	93091219	missense	probably benign	0.07
R3888:Cmya5	UTSW	13	93093656	missense	probably benign
R3897:Cmya5	UTSW	13	93096681	missense	possibly damaging	0.72
R3952:Cmya5	UTSW	13	93089199	missense	possibly damaging	0.89
R4366:Cmya5	UTSW	13	93091956	missense	probably benign	0.36
R4471:Cmya5	UTSW	13	93092325	missense	probably benign	0.01
R4493:Cmya5	UTSW	13	93094065	missense	probably benign
R4495:Cmya5	UTSW	13	93094065	missense	probably benign
R4544:Cmya5	UTSW	13	93091918	nonsense	probably null
R4545:Cmya5	UTSW	13	93091918	nonsense	probably null
R4624:Cmya5	UTSW	13	93063551	missense	probably damaging	1.00
R4648:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R4824:Cmya5	UTSW	13	93093574	missense	probably benign	0.04
R4967:Cmya5	UTSW	13	93090585	missense	probably damaging	1.00
R5101:Cmya5	UTSW	13	93091603	missense	possibly damaging	0.61
R5133:Cmya5	UTSW	13	93093372	missense	possibly damaging	0.79
R5139:Cmya5	UTSW	13	93096061	missense	probably benign	0.00
R5220:Cmya5	UTSW	13	93092296	missense	probably damaging	0.99
R5332:Cmya5	UTSW	13	93096195	missense	probably damaging	0.96
R5337:Cmya5	UTSW	13	93083273	missense	probably benign	0.28
R5356:Cmya5	UTSW	13	93063485	missense	probably damaging	1.00
R5401:Cmya5	UTSW	13	93091968	missense	probably damaging	1.00
R5438:Cmya5	UTSW	13	93095199	missense	possibly damaging	0.89
R5604:Cmya5	UTSW	13	93092763	missense	probably benign	0.15
R5628:Cmya5	UTSW	13	93089710	missense	probably damaging	1.00
R5666:Cmya5	UTSW	13	93045949	missense	possibly damaging	0.75
R5687:Cmya5	UTSW	13	93098176	missense	possibly damaging	0.53
R5695:Cmya5	UTSW	13	93045866	critical splice donor site	probably null
R5806:Cmya5	UTSW	13	93093937	missense	possibly damaging	0.84
R5820:Cmya5	UTSW	13	93092780	missense	probably benign	0.04
R5872:Cmya5	UTSW	13	93097435	missense	probably benign	0.01
R5875:Cmya5	UTSW	13	93095184	missense	probably benign	0.13
R5896:Cmya5	UTSW	13	93045865	critical splice donor site	probably null
R5910:Cmya5	UTSW	13	93092643	missense	probably damaging	0.98
R5969:Cmya5	UTSW	13	93089544	missense	possibly damaging	0.78
R6064:Cmya5	UTSW	13	93089649	missense	probably damaging	1.00
R6081:Cmya5	UTSW	13	93144513	unclassified	probably benign
R6102:Cmya5	UTSW	13	93094231	missense	probably benign
R6117:Cmya5	UTSW	13	93095166	missense	probably damaging	0.98
R6188:Cmya5	UTSW	13	93093444	missense	possibly damaging	0.61
R6188:Cmya5	UTSW	13	93097276	missense	possibly damaging	0.73
R6219:Cmya5	UTSW	13	93094443	missense	probably damaging	1.00
R6229:Cmya5	UTSW	13	93093306	missense	probably benign	0.41
R6346:Cmya5	UTSW	13	93092190	missense	probably damaging	1.00
R6431:Cmya5	UTSW	13	93074464	missense	possibly damaging	0.60
R6436:Cmya5	UTSW	13	93089215	missense	probably damaging	0.98
R6598:Cmya5	UTSW	13	93089808	missense	probably benign	0.05
R6649:Cmya5	UTSW	13	93098025	missense	possibly damaging	0.91
R6652:Cmya5	UTSW	13	93092895	missense	probably benign	0.04
R6652:Cmya5	UTSW	13	93093039	missense	probably damaging	0.99
R6669:Cmya5	UTSW	13	93093259	missense	probably benign	0.03
R6881:Cmya5	UTSW	13	93090292	missense	probably damaging	1.00
R6909:Cmya5	UTSW	13	93091252	missense	probably benign	0.04
R6933:Cmya5	UTSW	13	93095136	missense	probably benign	0.03
R7021:Cmya5	UTSW	13	93093555	missense	possibly damaging	0.62
R7022:Cmya5	UTSW	13	93069278	critical splice donor site	probably null
R7068:Cmya5	UTSW	13	93092697	missense	possibly damaging	0.59
R7087:Cmya5	UTSW	13	93090975	missense	probably benign	0.00
R7088:Cmya5	UTSW	13	93091864	missense	possibly damaging	0.95
R7126:Cmya5	UTSW	13	93089940	missense	probably benign	0.41
R7177:Cmya5	UTSW	13	93095328	missense	probably benign	0.00
R7188:Cmya5	UTSW	13	93046038	missense	probably damaging	1.00
R7217:Cmya5	UTSW	13	93090430	missense	probably damaging	1.00
R7278:Cmya5	UTSW	13	93095700	missense	probably damaging	0.96
R7293:Cmya5	UTSW	13	93092797	missense	possibly damaging	0.90
R7332:Cmya5	UTSW	13	93092553	missense	possibly damaging	0.60
R7375:Cmya5	UTSW	13	93091661	missense	probably damaging	0.97
R7386:Cmya5	UTSW	13	93069323	missense	probably damaging	1.00
R7489:Cmya5	UTSW	13	93091838	missense	possibly damaging	0.87
R7529:Cmya5	UTSW	13	93097434	missense	probably benign	0.02
R7552:Cmya5	UTSW	13	93069312	missense	probably benign	0.41
R7624:Cmya5	UTSW	13	93090357	missense	possibly damaging	0.79
R7637:Cmya5	UTSW	13	93083212	missense	possibly damaging	0.87
R7673:Cmya5	UTSW	13	93094121	missense	probably benign	0.13
R7753:Cmya5	UTSW	13	93098172	missense	probably benign	0.18
R7757:Cmya5	UTSW	13	93098272	missense	possibly damaging	0.53
R7806:Cmya5	UTSW	13	93094262	missense	probably benign	0.00
R7825:Cmya5	UTSW	13	93097628	missense	possibly damaging	0.53
R7878:Cmya5	UTSW	13	93089757	missense	probably damaging	0.98
R7892:Cmya5	UTSW	13	93096357	missense	probably damaging	0.96
R7952:Cmya5	UTSW	13	93097004	small deletion	probably benign
R8127:Cmya5	UTSW	13	93094614	missense	probably damaging	0.99
R8256:Cmya5	UTSW	13	93093478	missense	possibly damaging	0.62
R8339:Cmya5	UTSW	13	93091634	nonsense	probably null
R8446:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R8553:Cmya5	UTSW	13	93093796	missense	probably benign	0.00
R8686:Cmya5	UTSW	13	93095380	missense	possibly damaging	0.91
R8748:Cmya5	UTSW	13	93089721	missense	probably damaging	1.00
R8783:Cmya5	UTSW	13	93089380	missense	possibly damaging	0.58
R8803:Cmya5	UTSW	13	93041483	missense	probably damaging	1.00
R8810:Cmya5	UTSW	13	93063540	missense	possibly damaging	0.47
R8937:Cmya5	UTSW	13	93096332	missense	probably benign	0.01
R8985:Cmya5	UTSW	13	93097156	missense	possibly damaging	0.73
R9017:Cmya5	UTSW	13	93092064	missense	probably benign	0.03
R9087:Cmya5	UTSW	13	93097203	missense	possibly damaging	0.72
R9133:Cmya5	UTSW	13	93097600	missense	possibly damaging	0.73
R9156:Cmya5	UTSW	13	93097370	missense	unknown
R9209:Cmya5	UTSW	13	93090358	missense	probably benign	0.45
R9222:Cmya5	UTSW	13	93094071	missense	probably benign	0.00
R9229:Cmya5	UTSW	13	93095668	missense	possibly damaging	0.92
R9382:Cmya5	UTSW	13	93093376	missense	probably benign
R9385:Cmya5	UTSW	13	93094372	missense	probably damaging	0.99
R9418:Cmya5	UTSW	13	93089701	missense	probably benign	0.22
R9452:Cmya5	UTSW	13	93095886	missense	probably benign
R9492:Cmya5	UTSW	13	93041314	makesense	probably null
R9600:Cmya5	UTSW	13	93090096	missense	probably damaging	1.00
R9712:Cmya5	UTSW	13	93065373	critical splice acceptor site	probably null
R9742:Cmya5	UTSW	13	93095427	missense	possibly damaging	0.89
RF020:Cmya5	UTSW	13	93069291	missense	possibly damaging	0.56
X0028:Cmya5	UTSW	13	93096687	missense	possibly damaging	0.53
Z1088:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93096790	missense	unknown
Z1177:Cmya5	UTSW	13	93063579	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACTTGTTCGGATGAGATGGCC -3'
(R):5'- GTCCCAACGTGTTTCTGAGC -3'

Sequencing Primer
(F):5'- CTTTCAGAAAGCAGCTCAGTG -3'
(R):5'- TCTGAGCCCATCATTCAGGCAG -3'

Posted On

2016-04-27