Incidental Mutation 'R0345:Chrnb4'
ID 38396
Institutional Source Beutler Lab
Gene Symbol Chrnb4
Ensembl Gene ENSMUSG00000035200
Gene Name cholinergic receptor, nicotinic, beta polypeptide 4
Synonyms Acrb-4, Acrb4
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R0345 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 55028154-55048779 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55035594 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 132 (V132A)
Ref Sequence ENSEMBL: ENSMUSP00000034854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034854]
AlphaFold Q8R493
Predicted Effect probably benign
Transcript: ENSMUST00000034854
AA Change: V132A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034854
Gene: ENSMUSG00000035200
AA Change: V132A

Pfam:Neur_chan_LBD 26 231 3.2e-70 PFAM
Pfam:Neur_chan_memb 238 481 6.1e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217609
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in hyperplasia of the bladder and altered bladder contractility. Mutant mice also exhibit a resistance to nicotine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Chrnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Chrnb4 APN 9 55036594 missense probably damaging 1.00
IGL02207:Chrnb4 APN 9 55035216 missense probably damaging 1.00
IGL03242:Chrnb4 APN 9 55035528 missense probably damaging 1.00
R0735:Chrnb4 UTSW 9 55043800 missense probably damaging 0.96
R1843:Chrnb4 UTSW 9 55034818 missense possibly damaging 0.93
R1975:Chrnb4 UTSW 9 55034818 missense probably damaging 0.99
R2204:Chrnb4 UTSW 9 55043848 missense probably damaging 1.00
R2427:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R3876:Chrnb4 UTSW 9 55043898 missense probably damaging 1.00
R4934:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R5094:Chrnb4 UTSW 9 55035313 missense probably benign 0.00
R5507:Chrnb4 UTSW 9 55035012 missense probably damaging 1.00
R6370:Chrnb4 UTSW 9 55034859 missense probably benign 0.00
R7556:Chrnb4 UTSW 9 55035055 missense probably benign 0.19
R8399:Chrnb4 UTSW 9 55043823 missense probably benign 0.02
R9140:Chrnb4 UTSW 9 55034671 missense
R9352:Chrnb4 UTSW 9 55043883 missense probably benign 0.07
X0062:Chrnb4 UTSW 9 55034680 missense probably benign 0.05
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- caacctggaaaaggaagaacac -3'
Posted On 2013-05-23