Incidental Mutation 'R4966:Ctnnd1'
ID383987
Institutional Source Beutler Lab
Gene Symbol Ctnnd1
Ensembl Gene ENSMUSG00000034101
Gene Namecatenin (cadherin associated protein), delta 1
SynonymsP120, p120-catenin, Ctnnd, Catns
MMRRC Submission 042562-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4966 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location84600071-84650765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84622073 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 69 (F69L)
Ref Sequence ENSEMBL: ENSMUSP00000107323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036811] [ENSMUST00000066177] [ENSMUST00000067232] [ENSMUST00000099941] [ENSMUST00000111670] [ENSMUST00000111675] [ENSMUST00000111676] [ENSMUST00000111677] [ENSMUST00000111678] [ENSMUST00000111684] [ENSMUST00000111685] [ENSMUST00000111686] [ENSMUST00000111687] [ENSMUST00000111691] [ENSMUST00000111694] [ENSMUST00000111688] [ENSMUST00000111695] [ENSMUST00000111693] [ENSMUST00000111689] [ENSMUST00000189772] [ENSMUST00000111690] [ENSMUST00000111697] [ENSMUST00000111696] [ENSMUST00000111692] [ENSMUST00000111698]
Predicted Effect probably benign
Transcript: ENSMUST00000036811
AA Change: F69L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042543
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066177
AA Change: F69L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000065252
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 1.2e-8 SMART
ARM 440 481 1.3e-10 SMART
ARM 482 539 3e-1 SMART
ARM 541 588 1.8e-2 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 5.7e-7 SMART
ARM 783 825 2.1e-1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067232
AA Change: F69L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000064518
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099941
SMART Domains Protein: ENSMUSP00000097524
Gene: ENSMUSG00000034101

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 8e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111670
SMART Domains Protein: ENSMUSP00000107299
Gene: ENSMUSG00000034101

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 9e-20 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111675
SMART Domains Protein: ENSMUSP00000107304
Gene: ENSMUSG00000034101

DomainStartEndE-ValueType
ARM 74 114 2.53e-6 SMART
ARM 117 158 2.8e-8 SMART
ARM 159 216 6.3e1 SMART
ARM 218 265 3.74e0 SMART
Blast:ARM 322 364 8e-20 BLAST
ARM 370 410 1.23e-4 SMART
ARM 460 502 4.41e1 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111676
SMART Domains Protein: ENSMUSP00000107305
Gene: ENSMUSG00000034101

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 1e-19 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 836 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111677
SMART Domains Protein: ENSMUSP00000107306
Gene: ENSMUSG00000034101

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 815 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111678
SMART Domains Protein: ENSMUSP00000107307
Gene: ENSMUSG00000034101

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 9e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111684
AA Change: F15L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107313
Gene: ENSMUSG00000034101
AA Change: F15L

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 889 901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111685
AA Change: F15L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107314
Gene: ENSMUSG00000034101
AA Change: F15L

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111686
AA Change: F15L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107315
Gene: ENSMUSG00000034101
AA Change: F15L

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111687
AA Change: F15L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107316
Gene: ENSMUSG00000034101
AA Change: F15L

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 8e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111691
AA Change: F69L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107320
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111694
AA Change: F69L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107323
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111688
AA Change: F15L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107317
Gene: ENSMUSG00000034101
AA Change: F15L

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111695
AA Change: F69L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107324
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145312
Predicted Effect probably benign
Transcript: ENSMUST00000111693
AA Change: F69L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107322
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111689
AA Change: F15L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107318
Gene: ENSMUSG00000034101
AA Change: F15L

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189772
AA Change: F69L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111690
AA Change: F15L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107319
Gene: ENSMUSG00000034101
AA Change: F15L

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111697
AA Change: F69L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107326
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111696
AA Change: F69L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107325
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111692
AA Change: F69L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107321
Gene: ENSMUSG00000034101
AA Change: F69L

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111698
AA Change: F5L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107327
Gene: ENSMUSG00000034101
AA Change: F5L

DomainStartEndE-ValueType
low complexity region 62 89 N/A INTRINSIC
ARM 333 373 2.53e-6 SMART
ARM 376 417 2.8e-8 SMART
ARM 418 475 6.3e1 SMART
ARM 477 524 3.74e0 SMART
Blast:ARM 581 623 8e-20 BLAST
ARM 629 669 1.23e-4 SMART
ARM 719 761 4.41e1 SMART
low complexity region 787 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126092
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 96% (94/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Armadillo protein family, which function in adhesion between cells and signal transduction. Multiple translation initiation codons and alternative splicing result in many different isoforms being translated. Not all of the full-length natures of the described transcript variants have been determined. Read-through transcription also exists between this gene and the neighboring upstream thioredoxin-related transmembrane protein 2 (TMX2) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene die shortly after birth and have morphological abnormalities of the salivary glands and lacrimal gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 probably benign Het
9030619P08Rik T A 15: 75,431,418 noncoding transcript Het
Abcb5 T A 12: 118,886,891 probably benign Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Actn1 T C 12: 80,173,130 I656V probably benign Het
Arhgef15 A G 11: 68,947,317 V659A probably benign Het
AW551984 T C 9: 39,597,176 E348G possibly damaging Het
Bbs2 A T 8: 94,080,807 V453E probably damaging Het
Caskin1 A T 17: 24,507,161 D1414V probably damaging Het
Ccdc57 A T 11: 120,861,152 S868T probably benign Het
Cdc34b A T 11: 94,742,261 I96F probably damaging Het
Cyld A G 8: 88,742,301 I567V possibly damaging Het
Dact3 G C 7: 16,886,088 V503L unknown Het
Dlg1 C T 16: 31,754,808 T9I probably benign Het
Dnase1 T C 16: 4,037,907 probably benign Het
Drc7 G A 8: 95,071,596 E490K probably benign Het
Drd4 T C 7: 141,293,777 M114T probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Fgfr1 C A 8: 25,572,445 Y665* probably null Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gnat1 A T 9: 107,677,234 M115K probably benign Het
Gpr45 A G 1: 43,033,120 T308A probably benign Het
Grm1 T A 10: 10,719,665 K740* probably null Het
Gtsf2 T C 15: 103,444,328 E88G possibly damaging Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ino80c T C 18: 24,106,645 D153G probably damaging Het
Ints11 T C 4: 155,886,928 F278L probably damaging Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mipep G T 14: 60,784,782 R32L probably damaging Het
Mon1a A G 9: 107,902,651 E473G probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Myh11 T C 16: 14,205,954 E1512G probably damaging Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Myo9a A G 9: 59,871,734 D1591G probably benign Het
Myof T A 19: 37,935,852 I1306F probably damaging Het
Nlgn1 C T 3: 25,920,237 G165D possibly damaging Het
Noc2l C G 4: 156,245,911 D513E probably damaging Het
Nup205 G A 6: 35,243,849 R1862H probably benign Het
Nup210l A G 3: 90,106,901 H65R probably benign Het
Olfr1388 A G 11: 49,444,118 D89G possibly damaging Het
Olfr827 A T 10: 130,210,437 M231K probably benign Het
Pcmtd1 C A 1: 7,161,009 Y176* probably null Het
Pde6h C T 6: 136,961,203 T58I possibly damaging Het
Pkd1 T C 17: 24,586,068 probably null Het
Polr1e G A 4: 45,029,429 A297T probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rdx T C 9: 52,075,009 V372A probably benign Het
Reep6 T A 10: 80,333,799 F107Y probably benign Het
Rere G T 4: 150,613,816 probably benign Het
Rmdn2 G T 17: 79,666,875 A266S probably damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Rnpepl1 A T 1: 92,916,761 N325I probably damaging Het
Rps6ka5 T A 12: 100,553,066 M763L probably benign Het
Ryr2 T C 13: 11,833,992 T361A probably benign Het
Ryr2 T C 13: 11,714,611 E2375G possibly damaging Het
Serpina3j T A 12: 104,319,784 C399* probably null Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Sim2 T C 16: 94,123,421 V475A probably benign Het
Slc24a5 G A 2: 125,068,268 V30I probably benign Het
Snrnp25 A G 11: 32,207,595 K58E probably damaging Het
Stx1b T C 7: 127,807,921 I55V probably damaging Het
Tacc2 T C 7: 130,728,777 S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 I114T probably benign Het
Tm2d3 A G 7: 65,697,721 N101S possibly damaging Het
Tmem201 G T 4: 149,718,687 Q575K probably benign Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trak2 G A 1: 58,919,321 T267I probably damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Ttbk2 A T 2: 120,773,277 F258L possibly damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn T C 2: 76,955,036 D665G probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Unc93b1 T C 19: 3,942,023 probably null Het
Uroc1 T C 6: 90,345,394 L300P probably damaging Het
Vmn2r67 A T 7: 85,136,385 V804E probably damaging Het
Wdr81 T A 11: 75,445,949 Q1538L probably benign Het
Zfp457 T A 13: 67,293,278 H315L probably damaging Het
Zfp518a T A 19: 40,915,851 V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 L171R probably benign Het
Zfp712 C T 13: 67,040,612 C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 N67S probably benign Het
Zmat4 T C 8: 23,902,069 S83P probably damaging Het
Other mutations in Ctnnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ctnnd1 APN 2 84609625 missense probably damaging 0.99
IGL00846:Ctnnd1 APN 2 84622010 critical splice donor site probably null
IGL00861:Ctnnd1 APN 2 84603752 missense probably damaging 0.97
IGL01394:Ctnnd1 APN 2 84605256 splice site probably benign
IGL02035:Ctnnd1 APN 2 84620081 missense probably damaging 1.00
IGL02536:Ctnnd1 APN 2 84605196 missense probably benign 0.00
IGL02859:Ctnnd1 APN 2 84619909 splice site probably benign
IGL03270:Ctnnd1 APN 2 84609727 splice site probably null
IGL02802:Ctnnd1 UTSW 2 84624462 start codon destroyed probably null 0.99
R0449:Ctnnd1 UTSW 2 84603262 missense possibly damaging 0.53
R0487:Ctnnd1 UTSW 2 84609067 missense probably damaging 1.00
R0652:Ctnnd1 UTSW 2 84602896 missense probably benign 0.40
R1503:Ctnnd1 UTSW 2 84605179 splice site probably null
R1701:Ctnnd1 UTSW 2 84608991 missense probably damaging 1.00
R1796:Ctnnd1 UTSW 2 84615209 missense probably damaging 1.00
R2001:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2002:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2185:Ctnnd1 UTSW 2 84612548 missense probably damaging 1.00
R2192:Ctnnd1 UTSW 2 84609563 missense probably damaging 1.00
R2203:Ctnnd1 UTSW 2 84616680 missense probably damaging 1.00
R2389:Ctnnd1 UTSW 2 84624271 missense probably null 0.94
R2872:Ctnnd1 UTSW 2 84620888 missense possibly damaging 0.88
R2872:Ctnnd1 UTSW 2 84620888 missense possibly damaging 0.88
R3846:Ctnnd1 UTSW 2 84616927 missense probably benign 0.04
R4019:Ctnnd1 UTSW 2 84619958 missense probably damaging 1.00
R4194:Ctnnd1 UTSW 2 84603701 missense possibly damaging 0.93
R4796:Ctnnd1 UTSW 2 84619926 missense probably damaging 1.00
R4847:Ctnnd1 UTSW 2 84622052 nonsense probably null
R4964:Ctnnd1 UTSW 2 84622073 missense possibly damaging 0.85
R5223:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5336:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5428:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5429:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5974:Ctnnd1 UTSW 2 84620915 nonsense probably null
R6018:Ctnnd1 UTSW 2 84650468 intron probably benign
R6285:Ctnnd1 UTSW 2 84613887 critical splice donor site probably null
R6562:Ctnnd1 UTSW 2 84624308 missense probably benign
R6661:Ctnnd1 UTSW 2 84609642 missense probably damaging 1.00
R6694:Ctnnd1 UTSW 2 84624505 start gained probably benign
R6769:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6769:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
R6916:Ctnnd1 UTSW 2 84609646 missense probably benign 0.02
R7025:Ctnnd1 UTSW 2 84610606 missense possibly damaging 0.82
R7208:Ctnnd1 UTSW 2 84622046 missense possibly damaging 0.48
R7466:Ctnnd1 UTSW 2 84610785 missense probably benign 0.30
R7583:Ctnnd1 UTSW 2 84612061 missense probably damaging 0.99
R8087:Ctnnd1 UTSW 2 84610876 missense possibly damaging 0.65
R8458:Ctnnd1 UTSW 2 84613943 missense probably damaging 1.00
R8723:Ctnnd1 UTSW 2 84620040 missense probably benign 0.03
X0062:Ctnnd1 UTSW 2 84615214 missense probably damaging 1.00
Z1177:Ctnnd1 UTSW 2 84615172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCTCCCTCAAAACAATTG -3'
(R):5'- GCCTGTAGAGGAAAGTGGTATC -3'

Sequencing Primer
(F):5'- CCCTCAAAACAATTGCAGTTTTTGG -3'
(R):5'- GTGGTATCTAAGATTGTTATGGAGTG -3'
Posted On2016-04-27