Incidental Mutation 'R4966:Polr1e'
ID383991
Institutional Source Beutler Lab
Gene Symbol Polr1e
Ensembl Gene ENSMUSG00000028318
Gene Namepolymerase (RNA) I polypeptide E
Synonyms53kDa, D030019D19Rik, Paf53, Praf1
MMRRC Submission 042562-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4966 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45018583-45036565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45029429 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 297 (A297T)
Ref Sequence ENSEMBL: ENSMUSP00000121007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029999] [ENSMUST00000052236] [ENSMUST00000107814] [ENSMUST00000133157]
Predicted Effect probably benign
Transcript: ENSMUST00000029999
AA Change: A345T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000029999
Gene: ENSMUSG00000028318
AA Change: A345T

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 51 476 2.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052236
SMART Domains Protein: ENSMUSP00000058233
Gene: ENSMUSG00000048232

DomainStartEndE-ValueType
FBOX 6 48 1.92e-6 SMART
PbH1 198 217 8.34e3 SMART
PbH1 238 260 1.37e3 SMART
CASH 337 511 7.29e-6 SMART
PbH1 423 444 1.41e2 SMART
PbH1 467 489 1.33e3 SMART
PbH1 490 512 1.32e2 SMART
PbH1 513 535 8.34e3 SMART
PbH1 536 558 2.87e1 SMART
CASH 536 672 5.49e1 SMART
PbH1 559 581 1.25e1 SMART
PbH1 582 604 2.64e2 SMART
PbH1 605 627 6.05e3 SMART
PbH1 628 650 2.46e2 SMART
PbH1 651 673 2.14e2 SMART
CASH 681 804 6.58e1 SMART
PbH1 713 735 6.52e2 SMART
PbH1 736 758 5.92e2 SMART
PbH1 760 782 1.13e3 SMART
PbH1 783 805 1.86e2 SMART
PbH1 828 850 9.32e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000054723
AA Change: A269T
SMART Domains Protein: ENSMUSP00000059941
Gene: ENSMUSG00000028318
AA Change: A269T

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 24 401 7.9e-104 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107814
AA Change: A297T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103444
Gene: ENSMUSG00000028318
AA Change: A297T

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 49 385 4.1e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133157
AA Change: A297T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121007
Gene: ENSMUSG00000028318
AA Change: A297T

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 49 431 1.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140008
SMART Domains Protein: ENSMUSP00000119862
Gene: ENSMUSG00000048232

DomainStartEndE-ValueType
PbH1 25 44 8.34e3 SMART
PbH1 65 87 1.37e3 SMART
CASH 164 338 7.29e-6 SMART
PbH1 250 271 1.41e2 SMART
PbH1 294 316 1.33e3 SMART
PbH1 317 339 1.32e2 SMART
PbH1 340 362 8.34e3 SMART
PbH1 363 385 2.87e1 SMART
CASH 363 499 5.49e1 SMART
PbH1 386 408 1.25e1 SMART
PbH1 409 431 2.64e2 SMART
PbH1 432 454 6.05e3 SMART
PbH1 455 477 2.46e2 SMART
PbH1 478 500 2.14e2 SMART
CASH 508 631 6.58e1 SMART
PbH1 540 562 6.52e2 SMART
PbH1 563 585 5.92e2 SMART
PbH1 587 609 1.13e3 SMART
PbH1 610 632 1.86e2 SMART
PbH1 655 677 9.32e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153252
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 96% (94/98)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 probably benign Het
9030619P08Rik T A 15: 75,431,418 noncoding transcript Het
Abcb5 T A 12: 118,886,891 probably benign Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Actn1 T C 12: 80,173,130 I656V probably benign Het
Arhgef15 A G 11: 68,947,317 V659A probably benign Het
AW551984 T C 9: 39,597,176 E348G possibly damaging Het
Bbs2 A T 8: 94,080,807 V453E probably damaging Het
Caskin1 A T 17: 24,507,161 D1414V probably damaging Het
Ccdc57 A T 11: 120,861,152 S868T probably benign Het
Cdc34b A T 11: 94,742,261 I96F probably damaging Het
Ctnnd1 A G 2: 84,622,073 F69L possibly damaging Het
Cyld A G 8: 88,742,301 I567V possibly damaging Het
Dact3 G C 7: 16,886,088 V503L unknown Het
Dlg1 C T 16: 31,754,808 T9I probably benign Het
Dnase1 T C 16: 4,037,907 probably benign Het
Drc7 G A 8: 95,071,596 E490K probably benign Het
Drd4 T C 7: 141,293,777 M114T probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Fgfr1 C A 8: 25,572,445 Y665* probably null Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gnat1 A T 9: 107,677,234 M115K probably benign Het
Gpr45 A G 1: 43,033,120 T308A probably benign Het
Grm1 T A 10: 10,719,665 K740* probably null Het
Gtsf2 T C 15: 103,444,328 E88G possibly damaging Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ino80c T C 18: 24,106,645 D153G probably damaging Het
Ints11 T C 4: 155,886,928 F278L probably damaging Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mipep G T 14: 60,784,782 R32L probably damaging Het
Mon1a A G 9: 107,902,651 E473G probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Myh11 T C 16: 14,205,954 E1512G probably damaging Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Myo9a A G 9: 59,871,734 D1591G probably benign Het
Myof T A 19: 37,935,852 I1306F probably damaging Het
Nlgn1 C T 3: 25,920,237 G165D possibly damaging Het
Noc2l C G 4: 156,245,911 D513E probably damaging Het
Nup205 G A 6: 35,243,849 R1862H probably benign Het
Nup210l A G 3: 90,106,901 H65R probably benign Het
Olfr1388 A G 11: 49,444,118 D89G possibly damaging Het
Olfr827 A T 10: 130,210,437 M231K probably benign Het
Pcmtd1 C A 1: 7,161,009 Y176* probably null Het
Pde6h C T 6: 136,961,203 T58I possibly damaging Het
Pkd1 T C 17: 24,586,068 probably null Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rdx T C 9: 52,075,009 V372A probably benign Het
Reep6 T A 10: 80,333,799 F107Y probably benign Het
Rere G T 4: 150,613,816 probably benign Het
Rmdn2 G T 17: 79,666,875 A266S probably damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Rnpepl1 A T 1: 92,916,761 N325I probably damaging Het
Rps6ka5 T A 12: 100,553,066 M763L probably benign Het
Ryr2 T C 13: 11,833,992 T361A probably benign Het
Ryr2 T C 13: 11,714,611 E2375G possibly damaging Het
Serpina3j T A 12: 104,319,784 C399* probably null Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Sim2 T C 16: 94,123,421 V475A probably benign Het
Slc24a5 G A 2: 125,068,268 V30I probably benign Het
Snrnp25 A G 11: 32,207,595 K58E probably damaging Het
Stx1b T C 7: 127,807,921 I55V probably damaging Het
Tacc2 T C 7: 130,728,777 S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 I114T probably benign Het
Tm2d3 A G 7: 65,697,721 N101S possibly damaging Het
Tmem201 G T 4: 149,718,687 Q575K probably benign Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trak2 G A 1: 58,919,321 T267I probably damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Ttbk2 A T 2: 120,773,277 F258L possibly damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn T C 2: 76,955,036 D665G probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Unc93b1 T C 19: 3,942,023 probably null Het
Uroc1 T C 6: 90,345,394 L300P probably damaging Het
Vmn2r67 A T 7: 85,136,385 V804E probably damaging Het
Wdr81 T A 11: 75,445,949 Q1538L probably benign Het
Zfp457 T A 13: 67,293,278 H315L probably damaging Het
Zfp518a T A 19: 40,915,851 V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 L171R probably benign Het
Zfp712 C T 13: 67,040,612 C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 N67S probably benign Het
Zmat4 T C 8: 23,902,069 S83P probably damaging Het
Other mutations in Polr1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Polr1e APN 4 45031364 unclassified probably benign
IGL01146:Polr1e APN 4 45031369 missense probably damaging 1.00
IGL01514:Polr1e APN 4 45018723 missense probably benign 0.00
IGL01533:Polr1e APN 4 45019328 missense probably damaging 1.00
R0207:Polr1e UTSW 4 45025143 splice site probably null
R0562:Polr1e UTSW 4 45029421 missense probably damaging 0.99
R0761:Polr1e UTSW 4 45027392 missense probably damaging 0.98
R1472:Polr1e UTSW 4 45028026 missense probably damaging 1.00
R1707:Polr1e UTSW 4 45027469 missense probably damaging 0.99
R2994:Polr1e UTSW 4 45027473 critical splice donor site probably null
R3054:Polr1e UTSW 4 45018724 missense possibly damaging 0.77
R4031:Polr1e UTSW 4 45018685 missense probably benign 0.02
R4195:Polr1e UTSW 4 45019327 missense probably damaging 1.00
R4771:Polr1e UTSW 4 45019282 missense probably damaging 1.00
R4806:Polr1e UTSW 4 45024482 missense probably benign
R4880:Polr1e UTSW 4 45022280 missense probably damaging 1.00
R4964:Polr1e UTSW 4 45029429 missense probably damaging 1.00
R5605:Polr1e UTSW 4 45018723 missense probably benign 0.00
R5934:Polr1e UTSW 4 45029369 missense probably damaging 0.99
R6358:Polr1e UTSW 4 45026813 missense probably damaging 1.00
R7241:Polr1e UTSW 4 45029340 missense probably damaging 1.00
R7436:Polr1e UTSW 4 45024553 splice site probably null
X0061:Polr1e UTSW 4 45029436 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACAGACAGTGTGCTGGGG -3'
(R):5'- TGTCCCCATTTCCAGAACAGAAG -3'

Sequencing Primer
(F):5'- GAGGGGGTGTGGCTCCTC -3'
(R):5'- AAGAGAGCCCTGTGTGGCTC -3'
Posted On2016-04-27