Incidental Mutation 'R4966:Tmem201'
ID383992
Institutional Source Beutler Lab
Gene Symbol Tmem201
Ensembl Gene ENSMUSG00000044700
Gene Nametransmembrane protein 201
SynonymsSamp1, D4Ertd429e
MMRRC Submission 042562-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R4966 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149715375-149738044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 149718687 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 575 (Q575K)
Ref Sequence ENSEMBL: ENSMUSP00000101312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054459] [ENSMUST00000105687]
Predicted Effect probably benign
Transcript: ENSMUST00000054459
AA Change: Q575K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050481
Gene: ENSMUSG00000044700
AA Change: Q575K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.6e-43 PFAM
Pfam:DUF2448 191 392 4.4e-102 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105687
AA Change: Q575K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101312
Gene: ENSMUSG00000044700
AA Change: Q575K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.4e-39 PFAM
Pfam:DUF2448 191 389 3.1e-96 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
transmembrane domain 638 660 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 96% (94/98)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 probably benign Het
9030619P08Rik T A 15: 75,431,418 noncoding transcript Het
Abcb5 T A 12: 118,886,891 probably benign Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Actn1 T C 12: 80,173,130 I656V probably benign Het
Arhgef15 A G 11: 68,947,317 V659A probably benign Het
AW551984 T C 9: 39,597,176 E348G possibly damaging Het
Bbs2 A T 8: 94,080,807 V453E probably damaging Het
Caskin1 A T 17: 24,507,161 D1414V probably damaging Het
Ccdc57 A T 11: 120,861,152 S868T probably benign Het
Cdc34b A T 11: 94,742,261 I96F probably damaging Het
Ctnnd1 A G 2: 84,622,073 F69L possibly damaging Het
Cyld A G 8: 88,742,301 I567V possibly damaging Het
Dact3 G C 7: 16,886,088 V503L unknown Het
Dlg1 C T 16: 31,754,808 T9I probably benign Het
Dnase1 T C 16: 4,037,907 probably benign Het
Drc7 G A 8: 95,071,596 E490K probably benign Het
Drd4 T C 7: 141,293,777 M114T probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Fgfr1 C A 8: 25,572,445 Y665* probably null Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gnat1 A T 9: 107,677,234 M115K probably benign Het
Gpr45 A G 1: 43,033,120 T308A probably benign Het
Grm1 T A 10: 10,719,665 K740* probably null Het
Gtsf2 T C 15: 103,444,328 E88G possibly damaging Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ino80c T C 18: 24,106,645 D153G probably damaging Het
Ints11 T C 4: 155,886,928 F278L probably damaging Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mipep G T 14: 60,784,782 R32L probably damaging Het
Mon1a A G 9: 107,902,651 E473G probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Myh11 T C 16: 14,205,954 E1512G probably damaging Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Myo9a A G 9: 59,871,734 D1591G probably benign Het
Myof T A 19: 37,935,852 I1306F probably damaging Het
Nlgn1 C T 3: 25,920,237 G165D possibly damaging Het
Noc2l C G 4: 156,245,911 D513E probably damaging Het
Nup205 G A 6: 35,243,849 R1862H probably benign Het
Nup210l A G 3: 90,106,901 H65R probably benign Het
Olfr1388 A G 11: 49,444,118 D89G possibly damaging Het
Olfr827 A T 10: 130,210,437 M231K probably benign Het
Pcmtd1 C A 1: 7,161,009 Y176* probably null Het
Pde6h C T 6: 136,961,203 T58I possibly damaging Het
Pkd1 T C 17: 24,586,068 probably null Het
Polr1e G A 4: 45,029,429 A297T probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rdx T C 9: 52,075,009 V372A probably benign Het
Reep6 T A 10: 80,333,799 F107Y probably benign Het
Rere G T 4: 150,613,816 probably benign Het
Rmdn2 G T 17: 79,666,875 A266S probably damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Rnpepl1 A T 1: 92,916,761 N325I probably damaging Het
Rps6ka5 T A 12: 100,553,066 M763L probably benign Het
Ryr2 T C 13: 11,714,611 E2375G possibly damaging Het
Ryr2 T C 13: 11,833,992 T361A probably benign Het
Serpina3j T A 12: 104,319,784 C399* probably null Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Sim2 T C 16: 94,123,421 V475A probably benign Het
Slc24a5 G A 2: 125,068,268 V30I probably benign Het
Snrnp25 A G 11: 32,207,595 K58E probably damaging Het
Stx1b T C 7: 127,807,921 I55V probably damaging Het
Tacc2 T C 7: 130,728,777 S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 I114T probably benign Het
Tm2d3 A G 7: 65,697,721 N101S possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trak2 G A 1: 58,919,321 T267I probably damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Ttbk2 A T 2: 120,773,277 F258L possibly damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn T C 2: 76,955,036 D665G probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Unc93b1 T C 19: 3,942,023 probably null Het
Uroc1 T C 6: 90,345,394 L300P probably damaging Het
Vmn2r67 A T 7: 85,136,385 V804E probably damaging Het
Wdr81 T A 11: 75,445,949 Q1538L probably benign Het
Zfp457 T A 13: 67,293,278 H315L probably damaging Het
Zfp518a T A 19: 40,915,851 V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 L171R probably benign Het
Zfp712 C T 13: 67,040,612 C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 N67S probably benign Het
Zmat4 T C 8: 23,902,069 S83P probably damaging Het
Other mutations in Tmem201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Tmem201 APN 4 149719588 splice site probably benign
R0508:Tmem201 UTSW 4 149731886 missense probably damaging 1.00
R0717:Tmem201 UTSW 4 149718810 missense probably damaging 1.00
R1660:Tmem201 UTSW 4 149719575 missense probably damaging 1.00
R2138:Tmem201 UTSW 4 149718080 missense probably damaging 1.00
R2971:Tmem201 UTSW 4 149722445 splice site probably benign
R4430:Tmem201 UTSW 4 149731139 missense probably benign 0.03
R4704:Tmem201 UTSW 4 149727317 missense possibly damaging 0.77
R4876:Tmem201 UTSW 4 149722270 missense probably damaging 1.00
R4991:Tmem201 UTSW 4 149728155 missense possibly damaging 0.95
R5518:Tmem201 UTSW 4 149718077 missense probably benign
R5818:Tmem201 UTSW 4 149727392 missense probably benign 0.33
R7399:Tmem201 UTSW 4 149731097 missense possibly damaging 0.95
R8142:Tmem201 UTSW 4 149718657 missense probably benign
X0064:Tmem201 UTSW 4 149718071 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CAGGCTCTGAAAGGATACAGC -3'
(R):5'- TTCGTGAGCTGAGGGAATGC -3'

Sequencing Primer
(F):5'- GGATACAGCTATCCACCAGTCTAGTG -3'
(R):5'- AATGCACCAGGTCCCAGTG -3'
Posted On2016-04-27