Mutagenetix > Incidental Mutations

Incidental Mutation 'R0345:Llgl2'

38402

Institutional Source

Beutler Lab

Gene Symbol

Llgl2

Ensembl Gene

ENSMUSG00000020782

Gene Name

LLGL2 scribble cell polarity complex component

Synonyms

9130006H11Rik

MMRRC Submission

038552-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.253) question?

Stock #

R0345 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115824049-115855780 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 115849992 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000133250] [ENSMUST00000137900] [ENSMUST00000155878] [ENSMUST00000173289] [ENSMUST00000177736]

Predicted Effect

probably benign
Transcript: ENSMUST00000103032

SMART Domains

Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
WD40	24	60	9.17e1	SMART
WD40	62	101	7.96e0	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	3.96e1	SMART
WD40	221	258	5.7e1	SMART
Pfam:LLGL	268	372	3.2e-47	PFAM
WD40	411	451	1.38e0	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	830	879	2e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000128826

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130518

Predicted Effect

probably benign
Transcript: ENSMUST00000133250

SMART Domains

Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	146	1e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137900

SMART Domains

Protein: ENSMUSP00000119675
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	3e-20	BLAST
SCOP:d1gxra_	19	158	7e-9	SMART
Blast:WD40	62	101	6e-22	BLAST
Blast:WD40	112	157	2e-22	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147878

Predicted Effect

probably benign
Transcript: ENSMUST00000155878

SMART Domains

Protein: ENSMUSP00000117649
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	1e-20	BLAST
SCOP:d1gxra_	19	118	3e-8	SMART
Blast:WD40	62	101	3e-22	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173289

SMART Domains

Protein: ENSMUSP00000133790
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	148	4e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000177736

SMART Domains

Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
WD40	24	60	5.9e-1	SMART
WD40	62	101	5.2e-2	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	2.5e-1	SMART
WD40	221	258	3.6e-1	SMART
Pfam:LLGL	271	372	6.2e-41	PFAM
WD40	411	451	8.8e-3	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	854	903	2e-10	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 94.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	C	14: 59,139,630	N105D	possibly damaging	Het
A2m	T	C	6: 121,638,272		probably benign	Het
Adgrb1	A	G	15: 74,543,349	N641S	probably damaging	Het
Aff4	T	A	11: 53,372,881	S243T	probably benign	Het
Agap2	A	G	10: 127,087,895	H713R	unknown	Het
Ap2a2	T	A	7: 141,631,293	M914K	probably damaging	Het
Bcl7c	A	T	7: 127,708,463	M22K	possibly damaging	Het
Cacna1i	A	T	15: 80,372,462	D1019V	probably damaging	Het
Cd7	T	C	11: 121,038,186	T80A	probably benign	Het
Chia1	T	C	3: 106,122,439	Y130H	probably damaging	Het
Chmp6	T	C	11: 119,918,046		probably benign	Het
Chrnb4	A	G	9: 55,035,594	V132A	probably benign	Het
Ctnna3	A	G	10: 63,566,840	D110G	probably benign	Het
Cyp2d37-ps	A	T	15: 82,689,774		noncoding transcript	Het
Dnah6	T	C	6: 73,021,257	M4061V	probably benign	Het
Dydc2	C	A	14: 41,061,946	M73I	probably benign	Het
Egflam	G	T	15: 7,289,994		probably null	Het
Fam205a1	T	C	4: 42,851,116	I347V	probably benign	Het
Fam228b	C	T	12: 4,748,351	V151I	possibly damaging	Het
Fam46b	A	T	4: 133,486,211	Q131L	probably benign	Het
Fanca	C	T	8: 123,304,813	V380I	probably damaging	Het
Gbp2b	T	C	3: 142,608,183	L408S	probably damaging	Het
Kcnh4	T	C	11: 100,757,681	S66G	probably benign	Het
Kcnq3	A	T	15: 66,020,305	V407D	possibly damaging	Het
Kif24	A	T	4: 41,428,413	D182E	probably benign	Het
Lmo7	T	A	14: 101,876,877	N140K	probably damaging	Het
Myo5c	A	G	9: 75,297,419	E1518G	probably damaging	Het
Myof	A	T	19: 38,024,345	N47K	probably damaging	Het
Nckap1	G	T	2: 80,544,977		probably benign	Het
Nlrp1a	C	A	11: 71,123,675	G250W	probably damaging	Het
Nol4l	T	A	2: 153,411,752	S390C	probably benign	Het
Olfr196	G	A	16: 59,167,906	P79L	possibly damaging	Het
Olfr670	T	A	7: 104,960,181	M184L	probably damaging	Het
Olfr701	T	C	7: 106,818,701	F206S	probably benign	Het
Olfr992	T	C	2: 85,400,341	Q64R	possibly damaging	Het
Plec	G	T	15: 76,177,167	P2886T	probably damaging	Het
Prdm16	T	C	4: 154,341,111	Y738C	probably benign	Het
Ptprz1	A	G	6: 23,016,165	Y820C	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sgce	G	A	6: 4,718,019	P98S	probably damaging	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc6a16	C	T	7: 45,259,248	A84V	possibly damaging	Het
Sntb2	T	C	8: 107,001,538	S373P	probably damaging	Het
Sorcs2	C	T	5: 36,027,874	V953I	probably benign	Het
St7l	T	C	3: 104,895,809		probably benign	Het
Stap2	A	G	17: 56,000,097	V217A	probably damaging	Het
Stxbp5l	A	T	16: 37,288,308	D215E	probably damaging	Het
Synm	C	T	7: 67,735,821	V256I	probably benign	Het
Syt13	A	C	2: 92,946,067	E233A	possibly damaging	Het
Tecta	T	A	9: 42,384,218	E327V	probably damaging	Het
Themis3	A	T	17: 66,559,545		probably null	Het
Ttll13	T	A	7: 80,247,336	D14E	probably benign	Het
Tubb2a	A	C	13: 34,076,637	D26E	probably benign	Het
Ubr1	T	C	2: 120,904,103		probably null	Het
Vps13d	A	T	4: 145,117,625	V2537E	possibly damaging	Het
Zscan10	T	A	17: 23,610,082	F456I	probably damaging	Het
Zyg11b	A	G	4: 108,266,407	I121T	probably damaging	Het

Other mutations in Llgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Llgl2	APN	11	115834884	missense	probably benign	0.00
IGL01145:Llgl2	APN	11	115853805	missense	probably benign
IGL01344:Llgl2	APN	11	115851193	missense	probably benign	0.01
IGL01980:Llgl2	APN	11	115850025	missense	probably damaging	1.00
IGL02220:Llgl2	APN	11	115845379	missense	possibly damaging	0.64
IGL02341:Llgl2	APN	11	115851120	missense	possibly damaging	0.70
IGL02399:Llgl2	APN	11	115844835	missense	probably damaging	0.97
IGL02415:Llgl2	APN	11	115853285	missense	probably damaging	0.98
IGL02632:Llgl2	APN	11	115844872	missense	probably damaging	1.00
IGL02990:Llgl2	APN	11	115854333	missense	probably benign	0.01
IGL03405:Llgl2	APN	11	115850842	missense	probably benign	0.09
R0097:Llgl2	UTSW	11	115844497	nonsense	probably null
R0166:Llgl2	UTSW	11	115844854	missense	probably damaging	1.00
R0277:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0323:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0614:Llgl2	UTSW	11	115850267	missense	probably damaging	1.00
R0980:Llgl2	UTSW	11	115850001	missense	probably damaging	1.00
R1387:Llgl2	UTSW	11	115853132	missense	probably damaging	0.99
R1456:Llgl2	UTSW	11	115845499	missense	probably benign	0.00
R1541:Llgl2	UTSW	11	115853121	missense	probably benign	0.00
R1832:Llgl2	UTSW	11	115851100	missense	probably damaging	1.00
R1950:Llgl2	UTSW	11	115851066	missense	probably damaging	0.96
R2991:Llgl2	UTSW	11	115851120	missense	probably benign	0.05
R4018:Llgl2	UTSW	11	115847612	missense	probably benign	0.31
R4582:Llgl2	UTSW	11	115850706	missense	possibly damaging	0.89
R4729:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R4907:Llgl2	UTSW	11	115853974	nonsense	probably null
R5000:Llgl2	UTSW	11	115844902	missense	probably benign
R5016:Llgl2	UTSW	11	115853424	missense	probably damaging	1.00
R5175:Llgl2	UTSW	11	115850721	missense	probably damaging	1.00
R5857:Llgl2	UTSW	11	115850281	missense	probably damaging	1.00
R6190:Llgl2	UTSW	11	115846986	missense	probably benign	0.00
R6451:Llgl2	UTSW	11	115844941	missense	probably damaging	0.99
R6804:Llgl2	UTSW	11	115843315	critical splice acceptor site	probably null
R6909:Llgl2	UTSW	11	115850799	missense	probably damaging	1.00
R7324:Llgl2	UTSW	11	115850730	missense	possibly damaging	0.49
R7332:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R7715:Llgl2	UTSW	11	115849728	missense	probably benign
R8038:Llgl2	UTSW	11	115851103	missense	probably benign	0.17
R8069:Llgl2	UTSW	11	115853286	missense	probably damaging	0.99
X0058:Llgl2	UTSW	11	115850637	missense	probably damaging	0.99
Z1176:Llgl2	UTSW	11	115849554	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTATGGGAACGCATCATCGC -3'
(R):5'- GGATCATCGCTGTAGGGATCAAAGG -3'

Sequencing Primer
(F):5'- TCTAGGAGTGGCCCATAGATG -3'
(R):5'- GGATCAAAGGAGCCCACCTG -3'

Posted On

2013-05-23