Incidental Mutation 'R4966:Myof'
ID 384061
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Name myoferlin
Synonyms Fer1l3, E030042N20Rik, 2310051D19Rik
MMRRC Submission 042562-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4966 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 37899036-38043577 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37935852 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1306 (I1306F)
Ref Sequence ENSEMBL: ENSMUSP00000153225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
AlphaFold Q69ZN7
Predicted Effect possibly damaging
Transcript: ENSMUST00000041475
AA Change: I1293F

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: I1293F

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172095
AA Change: I1293F

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: I1293F

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224518
Predicted Effect probably benign
Transcript: ENSMUST00000225159
AA Change: I777F

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably damaging
Transcript: ENSMUST00000226068
AA Change: I1306F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.2690 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 96% (94/98)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 (GRCm38) probably benign Het
9030619P08Rik T A 15: 75,431,418 (GRCm38) noncoding transcript Het
Abcb5 T A 12: 118,886,891 (GRCm38) probably benign Het
Acox3 A G 5: 35,589,736 (GRCm38) N166D probably damaging Het
Actn1 T C 12: 80,173,130 (GRCm38) I656V probably benign Het
Arhgef15 A G 11: 68,947,317 (GRCm38) V659A probably benign Het
AW551984 T C 9: 39,597,176 (GRCm38) E348G possibly damaging Het
Bbs2 A T 8: 94,080,807 (GRCm38) V453E probably damaging Het
Caskin1 A T 17: 24,507,161 (GRCm38) D1414V probably damaging Het
Ccdc57 A T 11: 120,861,152 (GRCm38) S868T probably benign Het
Cdc34b A T 11: 94,742,261 (GRCm38) I96F probably damaging Het
Ctnnd1 A G 2: 84,622,073 (GRCm38) F69L possibly damaging Het
Cyld A G 8: 88,742,301 (GRCm38) I567V possibly damaging Het
Dact3 G C 7: 16,886,088 (GRCm38) V503L unknown Het
Dlg1 C T 16: 31,754,808 (GRCm38) T9I probably benign Het
Dnase1 T C 16: 4,037,907 (GRCm38) probably benign Het
Drc7 G A 8: 95,071,596 (GRCm38) E490K probably benign Het
Drd4 T C 7: 141,293,777 (GRCm38) M114T probably damaging Het
Exoc3l4 A G 12: 111,428,721 (GRCm38) H591R probably benign Het
Fgfr1 C A 8: 25,572,445 (GRCm38) Y665* probably null Het
G2e3 A G 12: 51,371,630 (GRCm38) I603V probably benign Het
Glp2r G T 11: 67,757,593 (GRCm38) Y94* probably null Het
Gnat1 A T 9: 107,677,234 (GRCm38) M115K probably benign Het
Gpr45 A G 1: 43,033,120 (GRCm38) T308A probably benign Het
Grm1 T A 10: 10,719,665 (GRCm38) K740* probably null Het
Gtsf2 T C 15: 103,444,328 (GRCm38) E88G possibly damaging Het
Hsh2d C T 8: 72,193,528 (GRCm38) A23V probably benign Het
Ino80c T C 18: 24,106,645 (GRCm38) D153G probably damaging Het
Ints11 T C 4: 155,886,928 (GRCm38) F278L probably damaging Het
Ints6 A G 14: 62,702,462 (GRCm38) L593P probably damaging Het
Map4k1 A T 7: 28,983,002 (GRCm38) H16L probably benign Het
Mipep G T 14: 60,784,782 (GRCm38) R32L probably damaging Het
Mon1a A G 9: 107,902,651 (GRCm38) E473G probably damaging Het
Myf5 A T 10: 107,485,872 (GRCm38) C20* probably null Het
Myh11 T C 16: 14,205,954 (GRCm38) E1512G probably damaging Het
Myo5c T C 9: 75,269,596 (GRCm38) S608P probably benign Het
Myo9a A G 9: 59,871,734 (GRCm38) D1591G probably benign Het
Nlgn1 C T 3: 25,920,237 (GRCm38) G165D possibly damaging Het
Noc2l C G 4: 156,245,911 (GRCm38) D513E probably damaging Het
Nup205 G A 6: 35,243,849 (GRCm38) R1862H probably benign Het
Nup210l A G 3: 90,106,901 (GRCm38) H65R probably benign Het
Or2y16 A G 11: 49,444,118 (GRCm38) D89G possibly damaging Het
Or9k7 A T 10: 130,210,437 (GRCm38) M231K probably benign Het
Pcmtd1 C A 1: 7,161,009 (GRCm38) Y176* probably null Het
Pde6h C T 6: 136,961,203 (GRCm38) T58I possibly damaging Het
Pkd1 T C 17: 24,586,068 (GRCm38) probably null Het
Polr1e G A 4: 45,029,429 (GRCm38) A297T probably damaging Het
Rbm34 T C 8: 126,951,337 (GRCm38) D269G possibly damaging Het
Rdx T C 9: 52,075,009 (GRCm38) V372A probably benign Het
Reep6 T A 10: 80,333,799 (GRCm38) F107Y probably benign Het
Rere G T 4: 150,613,816 (GRCm38) probably benign Het
Rmdn2 G T 17: 79,666,875 (GRCm38) A266S probably damaging Het
Rnf32 G A 5: 29,198,578 (GRCm38) R7H probably benign Het
Rnpepl1 A T 1: 92,916,761 (GRCm38) N325I probably damaging Het
Rps6ka5 T A 12: 100,553,066 (GRCm38) M763L probably benign Het
Ryr2 T C 13: 11,714,611 (GRCm38) E2375G possibly damaging Het
Ryr2 T C 13: 11,833,992 (GRCm38) T361A probably benign Het
Serpina3j T A 12: 104,319,784 (GRCm38) C399* probably null Het
Serpinb9 T A 13: 33,008,864 (GRCm38) W135R probably damaging Het
Sim2 T C 16: 94,123,421 (GRCm38) V475A probably benign Het
Slc24a5 G A 2: 125,068,268 (GRCm38) V30I probably benign Het
Snrnp25 A G 11: 32,207,595 (GRCm38) K58E probably damaging Het
Stx1b T C 7: 127,807,921 (GRCm38) I55V probably damaging Het
Tacc2 T C 7: 130,728,777 (GRCm38) S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 (GRCm38) Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 (GRCm38) I114T probably benign Het
Tm2d3 A G 7: 65,697,721 (GRCm38) N101S possibly damaging Het
Tmem201 G T 4: 149,718,687 (GRCm38) Q575K probably benign Het
Tmem241 A G 18: 12,104,119 (GRCm38) S87P probably damaging Het
Trak2 G A 1: 58,919,321 (GRCm38) T267I probably damaging Het
Trmt2a T A 16: 18,249,554 (GRCm38) C30* probably null Het
Ttbk2 A T 2: 120,773,277 (GRCm38) F258L possibly damaging Het
Ttk T A 9: 83,865,148 (GRCm38) I680N probably benign Het
Ttn T C 2: 76,955,036 (GRCm38) D665G probably damaging Het
Tulp4 G A 17: 6,198,813 (GRCm38) E36K probably damaging Het
Unc93b1 T C 19: 3,942,023 (GRCm38) probably null Het
Uroc1 T C 6: 90,345,394 (GRCm38) L300P probably damaging Het
Vmn2r67 A T 7: 85,136,385 (GRCm38) V804E probably damaging Het
Wdr81 T A 11: 75,445,949 (GRCm38) Q1538L probably benign Het
Zfp457 T A 13: 67,293,278 (GRCm38) H315L probably damaging Het
Zfp518a T A 19: 40,915,851 (GRCm38) V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 (GRCm38) L171R probably benign Het
Zfp712 C T 13: 67,040,612 (GRCm38) C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 (GRCm38) N67S probably benign Het
Zmat4 T C 8: 23,902,069 (GRCm38) S83P probably damaging Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37,960,934 (GRCm38) missense probably benign 0.16
IGL00764:Myof APN 19 37,974,923 (GRCm38) missense probably benign 0.04
IGL00801:Myof APN 19 37,986,073 (GRCm38) missense probably damaging 0.99
IGL01084:Myof APN 19 37,936,436 (GRCm38) missense probably damaging 1.00
IGL01368:Myof APN 19 37,936,457 (GRCm38) missense probably damaging 0.97
IGL01472:Myof APN 19 37,923,076 (GRCm38) missense probably benign
IGL01785:Myof APN 19 37,980,423 (GRCm38) nonsense probably null
IGL02205:Myof APN 19 37,924,635 (GRCm38) missense probably damaging 1.00
IGL02268:Myof APN 19 37,974,863 (GRCm38) missense possibly damaging 0.90
IGL02268:Myof APN 19 37,954,429 (GRCm38) missense possibly damaging 0.50
IGL02339:Myof APN 19 37,972,213 (GRCm38) missense possibly damaging 0.46
IGL02433:Myof APN 19 37,972,193 (GRCm38) missense probably benign 0.05
IGL02481:Myof APN 19 37,937,913 (GRCm38) nonsense probably null
IGL02536:Myof APN 19 37,949,655 (GRCm38) missense probably damaging 0.97
IGL02682:Myof APN 19 37,921,481 (GRCm38) missense probably benign 0.09
IGL02732:Myof APN 19 37,977,716 (GRCm38) missense possibly damaging 0.50
IGL02887:Myof APN 19 37,920,779 (GRCm38) critical splice acceptor site probably null
IGL03114:Myof APN 19 37,903,861 (GRCm38) missense probably damaging 1.00
IGL03137:Myof APN 19 37,974,889 (GRCm38) missense probably damaging 1.00
IGL03340:Myof APN 19 37,911,159 (GRCm38) missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37,982,958 (GRCm38) critical splice donor site probably null
R0024:Myof UTSW 19 37,915,740 (GRCm38) missense probably damaging 0.98
R0140:Myof UTSW 19 37,951,556 (GRCm38) nonsense probably null
R0309:Myof UTSW 19 37,981,266 (GRCm38) missense probably benign 0.12
R0330:Myof UTSW 19 37,935,878 (GRCm38) missense probably damaging 1.00
R0345:Myof UTSW 19 38,024,345 (GRCm38) missense probably damaging 1.00
R0349:Myof UTSW 19 37,910,969 (GRCm38) missense probably damaging 0.99
R0463:Myof UTSW 19 37,916,504 (GRCm38) missense probably damaging 1.00
R0507:Myof UTSW 19 37,901,277 (GRCm38) missense possibly damaging 0.94
R0512:Myof UTSW 19 37,954,524 (GRCm38) missense possibly damaging 0.54
R0608:Myof UTSW 19 37,916,504 (GRCm38) missense probably damaging 1.00
R0723:Myof UTSW 19 37,981,260 (GRCm38) missense probably damaging 1.00
R1081:Myof UTSW 19 37,986,088 (GRCm38) missense probably damaging 0.99
R1196:Myof UTSW 19 37,910,960 (GRCm38) missense probably damaging 1.00
R1243:Myof UTSW 19 37,936,092 (GRCm38) missense probably damaging 1.00
R1371:Myof UTSW 19 37,903,668 (GRCm38) splice site probably benign
R1381:Myof UTSW 19 37,995,485 (GRCm38) missense probably damaging 1.00
R1419:Myof UTSW 19 37,901,911 (GRCm38) missense probably damaging 1.00
R1527:Myof UTSW 19 37,924,619 (GRCm38) missense probably damaging 1.00
R1672:Myof UTSW 19 37,943,479 (GRCm38) missense probably damaging 1.00
R1864:Myof UTSW 19 37,986,705 (GRCm38) missense probably benign
R1914:Myof UTSW 19 37,977,693 (GRCm38) missense probably damaging 1.00
R1915:Myof UTSW 19 37,977,693 (GRCm38) missense probably damaging 1.00
R1970:Myof UTSW 19 37,945,634 (GRCm38) missense probably damaging 0.99
R2062:Myof UTSW 19 37,915,746 (GRCm38) missense possibly damaging 0.94
R2144:Myof UTSW 19 37,981,221 (GRCm38) critical splice donor site probably null
R2243:Myof UTSW 19 37,901,319 (GRCm38) missense probably damaging 1.00
R2339:Myof UTSW 19 37,937,927 (GRCm38) missense probably damaging 1.00
R2484:Myof UTSW 19 37,903,843 (GRCm38) missense probably benign 0.13
R2880:Myof UTSW 19 37,923,025 (GRCm38) missense probably benign 0.04
R3418:Myof UTSW 19 37,922,978 (GRCm38) missense probably damaging 0.97
R3967:Myof UTSW 19 38,022,610 (GRCm38) missense possibly damaging 0.59
R3967:Myof UTSW 19 37,901,263 (GRCm38) missense probably damaging 1.00
R3970:Myof UTSW 19 38,022,610 (GRCm38) missense possibly damaging 0.59
R3970:Myof UTSW 19 37,901,263 (GRCm38) missense probably damaging 1.00
R4238:Myof UTSW 19 37,923,008 (GRCm38) nonsense probably null
R4405:Myof UTSW 19 37,922,978 (GRCm38) missense probably damaging 0.97
R4406:Myof UTSW 19 37,922,978 (GRCm38) missense probably damaging 0.97
R4407:Myof UTSW 19 37,922,978 (GRCm38) missense probably damaging 0.97
R4408:Myof UTSW 19 37,922,978 (GRCm38) missense probably damaging 0.97
R4561:Myof UTSW 19 37,922,990 (GRCm38) missense probably benign
R4606:Myof UTSW 19 37,967,099 (GRCm38) missense probably damaging 1.00
R4778:Myof UTSW 19 37,949,563 (GRCm38) missense probably damaging 1.00
R4801:Myof UTSW 19 37,945,738 (GRCm38) missense probably benign 0.24
R4802:Myof UTSW 19 37,945,738 (GRCm38) missense probably benign 0.24
R4812:Myof UTSW 19 37,916,559 (GRCm38) missense probably damaging 1.00
R4884:Myof UTSW 19 37,942,357 (GRCm38) missense probably damaging 1.00
R4964:Myof UTSW 19 37,935,852 (GRCm38) missense probably damaging 0.97
R5069:Myof UTSW 19 37,905,325 (GRCm38) missense possibly damaging 0.65
R5181:Myof UTSW 19 37,932,623 (GRCm38) missense possibly damaging 0.95
R5376:Myof UTSW 19 37,916,400 (GRCm38) missense probably damaging 1.00
R5384:Myof UTSW 19 37,952,987 (GRCm38) missense probably damaging 0.98
R5543:Myof UTSW 19 37,981,330 (GRCm38) missense probably benign 0.00
R5626:Myof UTSW 19 37,922,990 (GRCm38) missense probably benign
R5865:Myof UTSW 19 37,910,934 (GRCm38) missense probably damaging 1.00
R5919:Myof UTSW 19 38,024,370 (GRCm38) missense possibly damaging 0.95
R5924:Myof UTSW 19 37,982,973 (GRCm38) missense probably damaging 0.97
R5997:Myof UTSW 19 37,905,299 (GRCm38) missense possibly damaging 0.90
R5999:Myof UTSW 19 37,939,856 (GRCm38) nonsense probably null
R6039:Myof UTSW 19 37,977,684 (GRCm38) missense probably damaging 1.00
R6039:Myof UTSW 19 37,977,684 (GRCm38) missense probably damaging 1.00
R6041:Myof UTSW 19 37,924,620 (GRCm38) missense probably damaging 1.00
R6051:Myof UTSW 19 38,024,361 (GRCm38) missense probably damaging 1.00
R6057:Myof UTSW 19 37,926,981 (GRCm38) critical splice donor site probably null
R6089:Myof UTSW 19 37,967,060 (GRCm38) missense probably benign 0.37
R6195:Myof UTSW 19 37,913,357 (GRCm38) missense possibly damaging 0.89
R6478:Myof UTSW 19 37,903,831 (GRCm38) missense probably damaging 1.00
R6545:Myof UTSW 19 37,942,297 (GRCm38) missense possibly damaging 0.67
R6655:Myof UTSW 19 37,934,791 (GRCm38) missense probably damaging 1.00
R6715:Myof UTSW 19 37,968,346 (GRCm38) missense probably benign 0.04
R6737:Myof UTSW 19 37,943,514 (GRCm38) missense probably benign 0.01
R6837:Myof UTSW 19 37,922,956 (GRCm38) critical splice donor site probably null
R7096:Myof UTSW 19 37,936,200 (GRCm38) missense probably damaging 1.00
R7308:Myof UTSW 19 37,910,911 (GRCm38) missense probably damaging 0.98
R7328:Myof UTSW 19 37,916,399 (GRCm38) missense probably damaging 1.00
R7485:Myof UTSW 19 37,951,491 (GRCm38) nonsense probably null
R7554:Myof UTSW 19 37,954,510 (GRCm38) missense probably benign 0.09
R7759:Myof UTSW 19 37,939,898 (GRCm38) missense probably benign 0.00
R7779:Myof UTSW 19 37,939,390 (GRCm38) missense probably damaging 1.00
R8116:Myof UTSW 19 37,932,719 (GRCm38) missense probably damaging 0.99
R8264:Myof UTSW 19 37,921,433 (GRCm38) missense probably damaging 1.00
R8415:Myof UTSW 19 37,995,424 (GRCm38) missense probably benign
R8756:Myof UTSW 19 37,939,952 (GRCm38) missense probably benign
R8777:Myof UTSW 19 37,980,393 (GRCm38) missense probably benign 0.01
R8777-TAIL:Myof UTSW 19 37,980,393 (GRCm38) missense probably benign 0.01
R8835:Myof UTSW 19 37,967,099 (GRCm38) missense possibly damaging 0.92
R9046:Myof UTSW 19 37,934,664 (GRCm38) intron probably benign
R9396:Myof UTSW 19 37,934,846 (GRCm38) missense probably damaging 1.00
R9415:Myof UTSW 19 37,952,964 (GRCm38) missense probably damaging 1.00
R9450:Myof UTSW 19 37,960,926 (GRCm38) missense probably damaging 1.00
R9451:Myof UTSW 19 37,977,648 (GRCm38) critical splice donor site probably null
R9537:Myof UTSW 19 37,907,606 (GRCm38) missense probably damaging 1.00
R9592:Myof UTSW 19 38,043,289 (GRCm38) missense probably damaging 0.99
R9616:Myof UTSW 19 37,934,815 (GRCm38) missense possibly damaging 0.52
R9751:Myof UTSW 19 37,936,370 (GRCm38) missense probably benign
X0024:Myof UTSW 19 37,974,597 (GRCm38) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AAGAAAGAAATCCCTGAGATCTGC -3'
(R):5'- TGGATTCCACGAGCTGCTTAG -3'

Sequencing Primer
(F):5'- AAATCCCTGAGATCTGCTTCTTATTG -3'
(R):5'- TTAGAGCACCTCAGTCATTCCAGG -3'
Posted On 2016-04-27