Mutagenetix > Incidental Mutation

Incidental Mutation 'R4967:Speg'

384065

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

MMRRC Submission

042563-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4967 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 75387869 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 192 (R192H)

Ref Sequence

ENSEMBL: ENSMUSP00000109220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113590] [ENSMUST00000125306] [ENSMUST00000148515]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087122
AA Change: R298H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: R298H

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113590
AA Change: R192H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207
AA Change: R192H

Domain	Start	End	E-Value	Type
low complexity region	186	212	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	253	262	N/A	INTRINSIC
low complexity region	306	317	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
IGc2	633	700	2.19e-9	SMART
low complexity region	752	764	N/A	INTRINSIC
IGc2	780	848	4.03e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125118

Predicted Effect

probably benign
Transcript: ENSMUST00000125306

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132100

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132222

Predicted Effect

probably benign
Transcript: ENSMUST00000132228

Predicted Effect

unknown
Transcript: ENSMUST00000137868
AA Change: R45H

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146705

Predicted Effect

probably damaging
Transcript: ENSMUST00000148515
AA Change: R143H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116953
Gene: ENSMUSG00000026207
AA Change: R143H

Domain	Start	End	E-Value	Type
low complexity region	113	126	N/A	INTRINSIC
low complexity region	137	163	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	204	213	N/A	INTRINSIC
low complexity region	257	268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187214

Meta Mutation Damage Score

0.0641

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

100% (102/102)

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	A	T	12: 72,909,728	Y199*	probably null	Het
Adhfe1	A	T	1: 9,566,804	I394F	probably benign	Het
Arhgap26	G	T	18: 39,246,840	R485L	probably damaging	Het
Atat1	T	A	17: 35,901,575	N231I	probably damaging	Het
B4galnt2	T	C	11: 95,869,274	N309S	probably benign	Het
Bank1	A	T	3: 136,066,373	F499I	probably damaging	Het
Bcl9l	A	G	9: 44,505,068	D146G	possibly damaging	Het
Bglap3	A	T	3: 88,376,364		probably benign	Het
Bscl2	C	A	19: 8,847,980	T376K	probably benign	Het
C87499	T	C	4: 88,629,195	T80A	probably damaging	Het
Cercam	A	T	2: 29,871,021		probably null	Het
Clec4f	C	T	6: 83,656,030	M1I	probably null	Het
Clec4n	A	T	6: 123,232,107	I14F	probably benign	Het
Cmya5	T	C	13: 93,090,585	E2665G	probably damaging	Het
Cog4	T	A	8: 110,852,283		probably null	Het
Cubn	A	G	2: 13,348,045	F1961L	probably benign	Het
Cyp4a29	A	T	4: 115,246,999	H88L	probably benign	Het
Dhdh	A	G	7: 45,479,106	L216P	probably damaging	Het
Dpp6	T	C	5: 27,666,511	F544S	probably damaging	Het
Dthd1	C	T	5: 62,888,206	T771I	probably benign	Het
Dusp27	A	T	1: 166,127,106	V25E	probably damaging	Het
Emc10	A	G	7: 44,493,188		probably null	Het
Fam198a	C	T	9: 121,965,718	R313W	probably damaging	Het
Fgg	A	T	3: 83,012,765	T284S	probably benign	Het
Gm3002	T	A	14: 3,824,737	N24K	probably damaging	Het
Gm8674	G	A	13: 49,901,998		noncoding transcript	Het
Gpr63	G	A	4: 25,008,368	W364*	probably null	Het
Hcn4	C	G	9: 58,859,828	P891A	unknown	Het
Hcrtr1	A	T	4: 130,130,999	F365I	possibly damaging	Het
Hmcn2	A	G	2: 31,354,164		probably null	Het
Hoxc5	T	A	15: 103,015,354	L194H	probably damaging	Het
Ifna11	A	G	4: 88,820,050	N31S	probably null	Het
Ikbke	GCC	G	1: 131,275,267		probably null	Het
Iqgap2	A	T	13: 95,630,006	D1496E	probably benign	Het
Kif28	G	T	1: 179,708,442	Q556K	probably damaging	Het
Klhl42	C	T	6: 147,108,004	T447I	possibly damaging	Het
Lrp1b	A	C	2: 41,788,974	D35E	probably damaging	Het
Lsm14b	A	G	2: 180,033,899		probably benign	Het
Map3k1	T	C	13: 111,772,738	E226G	probably damaging	Het
Map3k14	T	A	11: 103,239,531	N187Y	probably benign	Het
Mcm6	A	T	1: 128,335,849	V645E	probably damaging	Het
Mdh1b	G	T	1: 63,719,863	P190Q	probably damaging	Het
Meiob	T	G	17: 24,818,379	L77R	probably damaging	Het
Mkl1	C	A	15: 81,045,275		probably benign	Het
Mrgpra3	A	T	7: 47,589,519	F220I	probably benign	Het
Mtor	T	A	4: 148,491,360	S1324T	possibly damaging	Het
Myot	T	A	18: 44,354,928	D437E	possibly damaging	Het
Ncoa6	G	T	2: 155,421,332	T394K	possibly damaging	Het
Nf1	T	A	11: 79,565,553		probably null	Het
Nup210	T	A	6: 91,036,469	T1190S	possibly damaging	Het
Odf1	T	A	15: 38,226,408	I184N	probably damaging	Het
Olfr178	G	T	16: 58,889,594	Q209K	possibly damaging	Het
Olfr270	T	C	4: 52,970,960	V113A	possibly damaging	Het
Olfr353	A	G	2: 36,890,707	I47T	probably damaging	Het
Olfr959	C	T	9: 39,572,758	C167Y	probably damaging	Het
Padi1	A	G	4: 140,845,590	V21A	probably benign	Het
Pdzrn3	C	T	6: 101,151,590	R705H	probably damaging	Het
Pik3cb	T	C	9: 99,105,632	I18V	probably benign	Het
Pmpca	T	C	2: 26,390,308	S117P	probably damaging	Het
Poteg	T	A	8: 27,494,981		probably benign	Het
Rab30	G	A	7: 92,829,563	R72H	probably damaging	Het
Ramp2	T	A	11: 101,247,557		probably null	Het
Rbks	G	A	5: 31,624,532	T308I	probably damaging	Het
Rnf112	A	G	11: 61,452,926		probably benign	Het
Rnf38	G	A	4: 44,152,460	P3S	probably damaging	Het
Sec16a	A	G	2: 26,412,871	S2344P	probably benign	Het
Slc16a8	C	T	15: 79,252,884	V109M	possibly damaging	Het
Slc28a1	A	T	7: 81,142,009	T308S	possibly damaging	Het
Slc39a3	T	C	10: 81,031,619	T98A	possibly damaging	Het
Smarcc2	T	C	10: 128,483,180	F731L	probably damaging	Het
Smc4	A	G	3: 69,018,239		probably benign	Het
Sparcl1	T	G	5: 104,092,910	D216A	probably damaging	Het
Sspo	T	C	6: 48,464,605	L1892P	probably damaging	Het
Tacc2	A	G	7: 130,623,948	N807D	probably damaging	Het
Teddm1a	A	T	1: 153,892,233	K148*	probably null	Het
Tex15	T	A	8: 33,574,470	D1309E	probably benign	Het
Thbs1	A	T	2: 118,114,778	E277D	probably benign	Het
Ticrr	G	A	7: 79,660,410	R24Q	probably damaging	Het
Tigd4	A	G	3: 84,595,153	E459G	probably benign	Het
Tln2	C	A	9: 67,355,125	A615S	probably damaging	Het
Tmprss5	T	C	9: 49,115,517	V410A	probably damaging	Het
Tnrc6a	G	T	7: 123,189,872	W1638L	probably damaging	Het
Tpr	A	G	1: 150,410,059	D424G	probably damaging	Het
Trim34a	A	T	7: 104,261,064	K358*	probably null	Het
Tssk5	T	A	15: 76,374,656	D10V	possibly damaging	Het
Usp35	A	C	7: 97,313,575	L470R	probably damaging	Het
Usp42	T	C	5: 143,715,364	D968G	possibly damaging	Het
Utrn	A	G	10: 12,455,420	V2924A	probably damaging	Het
Wdtc1	C	A	4: 133,294,343	A627S	probably damaging	Het
Xrra1	A	G	7: 99,906,523	T366A	probably damaging	Het
Zfp712	T	A	13: 67,040,709	K585*	probably null	Het
Zfp97	T	A	17: 17,145,131	N297K	probably damaging	Het
Zfp97	G	T	17: 17,144,676	E146*	probably null	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0483:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1759:Speg	UTSW	1	75401162	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R1936:Speg	UTSW	1	75431408	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75430477	missense	probably benign	0.30
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6505:Speg	UTSW	1	75429523	missense	possibly damaging	0.93
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75406770	critical splice donor site	probably null
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75384835	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75431279	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75431309	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75402264	splice site	probably null
R8781:Speg	UTSW	1	75407021	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75405149	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75427438	critical splice donor site	probably null
R8881:Speg	UTSW	1	75401151	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75388873	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75422606	missense	probably benign	0.30
R9019:Speg	UTSW	1	75429238	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75388432	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75385010	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75422734	missense	probably benign	0.01
R9117:Speg	UTSW	1	75387800	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75390993	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75384854	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75421776	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75417733	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75422508	missense	probably benign
R9475:Speg	UTSW	1	75388091	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75415736	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75387803	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75422782	missense	probably benign	0.08
R9553:Speg	UTSW	1	75418001	missense	probably benign	0.00
R9767:Speg	UTSW	1	75427181	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75418973	nonsense	probably null
R9800:Speg	UTSW	1	75422714	missense	probably benign	0.03
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAAATCTGGCCCTTGTCACC -3'
(R):5'- TGTAGCTTGTCCAGGATGCG -3'

Sequencing Primer
(F):5'- TGGCCCTTGTCACCCCAAG -3'
(R):5'- AATGCTGACAGGCGACC -3'

Posted On

2016-04-27