Incidental Mutation 'R4968:Alpi'
ID384158
Institutional Source Beutler Lab
Gene Symbol Alpi
Ensembl Gene ENSMUSG00000079440
Gene Namealkaline phosphatase, intestinal
Synonyms2010001C14Rik
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4968 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87098002-87101606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87101525 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 4 (D4G)
Ref Sequence ENSEMBL: ENSMUSP00000108895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113270]
Predicted Effect probably benign
Transcript: ENSMUST00000113270
AA Change: D4G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108895
Gene: ENSMUSG00000079440
AA Change: D4G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
alkPPc 54 489 7.97e-247 SMART
low complexity region 509 532 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an alkaline phosphatase, a metalloenzyme that catalyzes the hydrolysis of phosphoric acid monoesters. It belongs to a multigene family composed of four alkaline phosphatase isoenzymes. The enzyme functions as a homodimer and has a catalytic site containing one magnesium and two zinc ions, which are required for its enzymatic function. The protein is primarily expressed in placental and endometrial tissue; however, strong ectopic expression has been detected in ovarian adenocarcinoma, serous cystadenocarcinoma, and other ovarian cancer cells. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Alpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Alpi APN 1 87099720 missense probably damaging 1.00
IGL01972:Alpi APN 1 87099709 missense probably damaging 1.00
IGL02672:Alpi APN 1 87101272 missense probably damaging 1.00
IGL03089:Alpi APN 1 87100108 missense probably benign 0.05
IGL03099:Alpi APN 1 87098631 missense unknown
IGL03154:Alpi APN 1 87100088 missense probably damaging 1.00
IGL03372:Alpi APN 1 87100628 splice site probably benign
K7371:Alpi UTSW 1 87099171 splice site probably benign
R0053:Alpi UTSW 1 87098790 missense probably benign 0.03
R0054:Alpi UTSW 1 87099765 missense possibly damaging 0.61
R0070:Alpi UTSW 1 87101159 splice site probably benign
R1586:Alpi UTSW 1 87100201 missense probably damaging 1.00
R1835:Alpi UTSW 1 87099414 missense possibly damaging 0.88
R2372:Alpi UTSW 1 87100594 missense probably damaging 1.00
R4546:Alpi UTSW 1 87099117 missense probably damaging 1.00
R4861:Alpi UTSW 1 87100469 missense probably damaging 0.98
R4861:Alpi UTSW 1 87100469 missense probably damaging 0.98
R5427:Alpi UTSW 1 87101354 missense probably benign 0.04
R6245:Alpi UTSW 1 87100834 missense probably damaging 1.00
R6394:Alpi UTSW 1 87100706 missense possibly damaging 0.71
R6398:Alpi UTSW 1 87099462 missense probably damaging 0.98
R6616:Alpi UTSW 1 87101114 missense possibly damaging 0.81
R7168:Alpi UTSW 1 87099433 missense possibly damaging 0.94
R7448:Alpi UTSW 1 87101535 start codon destroyed possibly damaging 0.79
R7473:Alpi UTSW 1 87099647 critical splice donor site probably null
R7527:Alpi UTSW 1 87098955 missense probably benign 0.01
R7552:Alpi UTSW 1 87099073 missense probably benign 0.00
R8008:Alpi UTSW 1 87098662 missense not run
X0052:Alpi UTSW 1 87100201 missense probably damaging 1.00
X0057:Alpi UTSW 1 87101078 missense probably damaging 1.00
Z1176:Alpi UTSW 1 87099072 missense not run
Predicted Primers PCR Primer
(F):5'- GAATGGGCTGCAGCTTCTTG -3'
(R):5'- GACTTCAGTTCACAGGGCAAG -3'

Sequencing Primer
(F):5'- AGCTTCTTGGCAGCATCCAG -3'
(R):5'- TTCACAGGGCAAGGGTGG -3'
Posted On2016-04-27