Incidental Mutation 'R0345:Stap2'
ID38416
Institutional Source Beutler Lab
Gene Symbol Stap2
Ensembl Gene ENSMUSG00000038781
Gene Namesignal transducing adaptor family member 2
SynonymsSTAP-2
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0345 (G1)
Quality Score220
Status Validated
Chromosome17
Chromosomal Location55997081-56005570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56000097 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 217 (V217A)
Ref Sequence ENSEMBL: ENSMUSP00000038130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011733] [ENSMUST00000043785]
Predicted Effect probably benign
Transcript: ENSMUST00000011733
SMART Domains Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589

DomainStartEndE-ValueType
BBC 4 130 7.61e-9 SMART
FN3 165 255 2.96e-4 SMART
Pfam:SPRY 355 473 6.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043785
AA Change: V217A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781
AA Change: V217A

DomainStartEndE-ValueType
PH 20 120 1.22e-3 SMART
SH2 150 239 2.58e-3 SMART
low complexity region 278 297 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 343 365 N/A INTRINSIC
Meta Mutation Damage Score 0.2893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the substrate of breast tumor kinase, an Src-type non-receptor tyrosine kinase. The encoded protein possesses domains and several tyrosine phosphorylation sites characteristic of adaptor proteins that mediate the interactions linking proteins involved in signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no apparent abnormalities in most organs at the gross and histological level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myo5c A G 9: 75,297,419 E1518G probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Stap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01578:Stap2 APN 17 55997623 missense probably benign 0.00
IGL02087:Stap2 APN 17 56005473 missense probably damaging 1.00
IGL02876:Stap2 APN 17 55999961 missense probably benign 0.00
IGL03101:Stap2 APN 17 56002029 missense probably damaging 1.00
R0033:Stap2 UTSW 17 55999976 missense probably damaging 1.00
R3405:Stap2 UTSW 17 55997511 missense probably benign 0.30
R3406:Stap2 UTSW 17 55997511 missense probably benign 0.30
R3929:Stap2 UTSW 17 56003156 missense probably damaging 1.00
R4210:Stap2 UTSW 17 55997827 nonsense probably null
R4543:Stap2 UTSW 17 55997604 critical splice donor site probably null
R4934:Stap2 UTSW 17 55997901 missense possibly damaging 0.69
R5748:Stap2 UTSW 17 56000475 splice site probably null
R6228:Stap2 UTSW 17 55999976 missense probably damaging 1.00
R6617:Stap2 UTSW 17 55999746 missense probably benign
R7092:Stap2 UTSW 17 56002954 missense probably benign 0.00
R7665:Stap2 UTSW 17 55997909 missense probably benign 0.00
R7879:Stap2 UTSW 17 56002023 missense probably benign 0.45
R7962:Stap2 UTSW 17 56002023 missense probably benign 0.45
R8008:Stap2 UTSW 17 55997790 missense probably benign 0.05
Z1088:Stap2 UTSW 17 55999748 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGAGTATCCCTGTCCAAGCCTG -3'
(R):5'- TCACCACCCGGCAGATTCTCAATG -3'

Sequencing Primer
(F):5'- TGTCCAAGCCTGGCAGC -3'
(R):5'- AAATGGTTAGTCCAGGCCC -3'
Posted On2013-05-23