Incidental Mutation 'R4968:St6galnac6'
ID384165
Institutional Source Beutler Lab
Gene Symbol St6galnac6
Ensembl Gene ENSMUSG00000026811
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
SynonymsST6GalNAcVI, Siat7f
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4968 (G1)
Quality Score109
Status Not validated
Chromosome2
Chromosomal Location32599709-32620806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32608086 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 6 (P6S)
Ref Sequence ENSEMBL: ENSMUSP00000138916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072111] [ENSMUST00000081879] [ENSMUST00000095044] [ENSMUST00000095045] [ENSMUST00000113290] [ENSMUST00000126636] [ENSMUST00000128811] [ENSMUST00000129165] [ENSMUST00000131229] [ENSMUST00000140983] [ENSMUST00000143625] [ENSMUST00000183538]
Predicted Effect probably benign
Transcript: ENSMUST00000072111
AA Change: P6S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071983
Gene: ENSMUSG00000026811
AA Change: P6S

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:Glyco_transf_29 55 328 2.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081879
SMART Domains Protein: ENSMUSP00000080555
Gene: ENSMUSG00000026811

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:Glyco_transf_29 62 329 2.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095044
AA Change: P6S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092654
Gene: ENSMUSG00000026811
AA Change: P6S

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:Glyco_transf_29 55 328 2.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095045
SMART Domains Protein: ENSMUSP00000092655
Gene: ENSMUSG00000026811

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 41 307 1.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113290
SMART Domains Protein: ENSMUSP00000108915
Gene: ENSMUSG00000026811

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 21 294 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126636
Predicted Effect probably benign
Transcript: ENSMUST00000128811
SMART Domains Protein: ENSMUSP00000118893
Gene: ENSMUSG00000026811

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 20 108 7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129165
Predicted Effect probably benign
Transcript: ENSMUST00000131229
SMART Domains Protein: ENSMUSP00000115430
Gene: ENSMUSG00000026811

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 35 176 3.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140983
SMART Domains Protein: ENSMUSP00000114934
Gene: ENSMUSG00000026811

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 21 229 7.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149220
Predicted Effect probably benign
Transcript: ENSMUST00000183538
AA Change: P6S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138916
Gene: ENSMUSG00000026811
AA Change: P6S

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:Glyco_transf_29 55 232 4.8e-24 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ST6GALNAC6 belongs to a family of sialyltransferases that modify proteins and ceramides on the cell surface to alter cell-cell or cell-extracellular matrix interactions (Tsuchida et al., 2003 [PubMed 12668675]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in St6galnac6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02736:St6galnac6 APN 2 32614971 missense probably benign 0.04
R0097:St6galnac6 UTSW 2 32599802 missense probably damaging 0.99
R1547:St6galnac6 UTSW 2 32614965 missense possibly damaging 0.75
R1654:St6galnac6 UTSW 2 32619509 missense probably damaging 1.00
R4385:St6galnac6 UTSW 2 32615024 missense possibly damaging 0.84
R4744:St6galnac6 UTSW 2 32618543 missense probably damaging 1.00
R5169:St6galnac6 UTSW 2 32614845 missense possibly damaging 0.91
R6037:St6galnac6 UTSW 2 32612228 missense probably damaging 1.00
R6037:St6galnac6 UTSW 2 32612228 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGAGCATGTTTCGTAATATAAGG -3'
(R):5'- TCCAGACACTTGGAGCACTC -3'

Sequencing Primer
(F):5'- GCATGTTTCGTAATATAAGGGAAGTC -3'
(R):5'- AGCACTCCAGGTCCCAG -3'
Posted On2016-04-27