Incidental Mutation 'R4968:Aplnr'
ID384170
Institutional Source Beutler Lab
Gene Symbol Aplnr
Ensembl Gene ENSMUSG00000044338
Gene Nameapelin receptor
Synonymsapelin receptor, APJ, Agtrl1, msr/apj
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4968 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85136225-85139923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85136945 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 105 (Y105H)
Ref Sequence ENSEMBL: ENSMUSP00000053638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057019] [ENSMUST00000184728]
Predicted Effect probably damaging
Transcript: ENSMUST00000057019
AA Change: Y105H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053638
Gene: ENSMUSG00000044338
AA Change: Y105H

DomainStartEndE-ValueType
Pfam:TAS2R 25 326 1.1e-8 PFAM
Pfam:7tm_1 43 307 4e-61 PFAM
Pfam:7TM_GPCR_Srv 46 324 3.5e-8 PFAM
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184728
SMART Domains Protein: ENSMUSP00000139142
Gene: ENSMUSG00000044338

DomainStartEndE-ValueType
SCOP:d1l9ha_ 1 47 7e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor gene family. The encoded protein is related to the angiotensin receptor, but is actually an apelin receptor that inhibits adenylate cyclase activity and plays a counter-regulatory role against the pressure action of angiotensin II by exerting hypertensive effect. It functions in the cardiovascular and central nervous systems, in glucose metabolism, in embryonic and tumor angiogenesis and as a human immunodeficiency virus (HIV-1) coreceptor. Two transcript variants resulting from alternative splicing have been identified. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early lethality, decreased cardiac contractility, and decreased exercise endurance. Mice for another knock-out allele develop pulmonary venoocclusive disease with heart right ventricle hypertrophy and elevated pulmonary pressures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Aplnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aplnr APN 2 85137641 missense probably benign 0.00
IGL00985:Aplnr APN 2 85137663 missense probably benign 0.02
PIT4810001:Aplnr UTSW 2 85137284 missense probably damaging 1.00
R0009:Aplnr UTSW 2 85137276 unclassified probably null
R0009:Aplnr UTSW 2 85137276 unclassified probably null
R0201:Aplnr UTSW 2 85137177 missense probably damaging 1.00
R1268:Aplnr UTSW 2 85137431 missense possibly damaging 0.80
R1386:Aplnr UTSW 2 85137461 missense possibly damaging 0.71
R1445:Aplnr UTSW 2 85137009 missense probably damaging 1.00
R1663:Aplnr UTSW 2 85136694 missense possibly damaging 0.53
R1967:Aplnr UTSW 2 85137606 missense probably benign
R4119:Aplnr UTSW 2 85136966 missense possibly damaging 0.96
R4672:Aplnr UTSW 2 85137180 missense probably damaging 1.00
R4916:Aplnr UTSW 2 85136917 missense probably damaging 1.00
R4990:Aplnr UTSW 2 85137377 missense probably damaging 0.96
R5067:Aplnr UTSW 2 85136784 missense probably damaging 1.00
R6235:Aplnr UTSW 2 85137626 missense probably benign
R6433:Aplnr UTSW 2 85136673 missense probably benign
R6828:Aplnr UTSW 2 85139759 utr 3 prime probably benign
R6898:Aplnr UTSW 2 85139811 utr 3 prime probably benign
R7547:Aplnr UTSW 2 85137177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCGTGTTTCGAACCAG -3'
(R):5'- CCATGTAGCACTGGATCTTGGTG -3'

Sequencing Primer
(F):5'- TGTTTCGAACCAGCCGCG -3'
(R):5'- TCTGTGGAACGGAACACCATGAC -3'
Posted On2016-04-27