Incidental Mutation 'R4968:Anks6'
ID 384174
Institutional Source Beutler Lab
Gene Symbol Anks6
Ensembl Gene ENSMUSG00000066191
Gene Name ankyrin repeat and sterile alpha motif domain containing 6
Synonyms SamCystin, 2210417J20Rik, Samd6, b2b1801.1Clo, LOC269533
MMRRC Submission 042564-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4968 (G1)
Quality Score 162
Status Not validated
Chromosome 4
Chromosomal Location 47015669-47057427 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 47030795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 601 (G601S)
Ref Sequence ENSEMBL: ENSMUSP00000081665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]
AlphaFold Q6GQX6
Predicted Effect probably damaging
Transcript: ENSMUST00000084616
AA Change: G601S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191
AA Change: G601S

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 539 575 N/A INTRINSIC
low complexity region 619 673 N/A INTRINSIC
SAM 700 766 2.73e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107747
AA Change: G669S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191
AA Change: G669S

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 607 643 N/A INTRINSIC
low complexity region 687 741 N/A INTRINSIC
low complexity region 748 768 N/A INTRINSIC
Blast:SAM 769 796 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000229609
AA Change: G669S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,769,616 (GRCm39) K53* probably null Het
4921513D11Rik T C 17: 79,935,651 (GRCm39) S255P probably benign Het
Ace A G 11: 105,872,679 (GRCm39) N367S possibly damaging Het
Agl A T 3: 116,582,175 (GRCm39) N282K probably benign Het
Ahnak C A 19: 8,992,464 (GRCm39) P4583T probably damaging Het
Alpi T C 1: 87,029,247 (GRCm39) D4G probably benign Het
Aplnr T C 2: 84,967,289 (GRCm39) Y105H probably damaging Het
Arhgap9 G A 10: 127,162,875 (GRCm39) R395K possibly damaging Het
Asah1 A G 8: 41,807,067 (GRCm39) M119T Het
Atp5f1b T C 10: 127,919,856 (GRCm39) F75L probably damaging Het
B4galt6 G T 18: 20,861,026 (GRCm39) N75K possibly damaging Het
Bco1 A T 8: 117,857,833 (GRCm39) H486L probably benign Het
Btaf1 T A 19: 36,947,351 (GRCm39) L480Q probably null Het
Ccdc34 G T 2: 109,871,078 (GRCm39) probably null Het
Cdh19 T C 1: 110,852,958 (GRCm39) S326G probably benign Het
Cep89 A G 7: 35,109,055 (GRCm39) D178G possibly damaging Het
Cyp11b2 A T 15: 74,725,854 (GRCm39) probably null Het
Cyp21a1 A G 17: 35,022,383 (GRCm39) I157T possibly damaging Het
Dcbld2 A G 16: 58,245,074 (GRCm39) D116G probably damaging Het
Ddx5 T C 11: 106,674,953 (GRCm39) Q377R probably damaging Het
Deup1 T C 9: 15,503,724 (GRCm39) D279G probably damaging Het
F11 G A 8: 45,698,770 (GRCm39) A458V probably benign Het
Fhad1 C A 4: 141,645,618 (GRCm39) G326W probably damaging Het
Fhit C T 14: 10,421,522 (GRCm38) V26M probably damaging Het
Gjb5 A T 4: 127,250,015 (GRCm39) V43E probably damaging Het
Grtp1 A T 8: 13,242,184 (GRCm39) I75N probably damaging Het
Hmcn1 A G 1: 150,533,221 (GRCm39) I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,881,962 (GRCm39) T166A probably benign Het
Ift70b T C 2: 75,768,391 (GRCm39) I121V probably benign Het
Iho1 C T 9: 108,289,713 (GRCm39) V170M probably benign Het
Ikbke GCC G 1: 131,203,004 (GRCm39) probably null Het
Kcnk10 T C 12: 98,401,161 (GRCm39) I491V probably benign Het
Kcp A T 6: 29,497,628 (GRCm39) C519* probably null Het
Lcmt2 T C 2: 120,970,217 (GRCm39) T69A probably benign Het
Lmf1 A G 17: 25,804,592 (GRCm39) Y90C probably damaging Het
Lpp A G 16: 24,798,064 (GRCm39) D612G probably damaging Het
Lrfn5 C A 12: 61,886,461 (GRCm39) S83Y probably damaging Het
Lrp1b C T 2: 41,679,074 (GRCm39) C6Y probably damaging Het
Lrp1b T C 2: 40,592,719 (GRCm39) probably null Het
Lrrc8c A G 5: 105,754,993 (GRCm39) D256G probably damaging Het
Mphosph10 A G 7: 64,032,656 (GRCm39) Y478H probably damaging Het
Mpp2 T C 11: 101,955,124 (GRCm39) H167R probably benign Het
Mtss1 A G 15: 58,815,767 (GRCm39) S598P probably damaging Het
Myh10 A G 11: 68,684,049 (GRCm39) E1154G probably damaging Het
Myo10 T C 15: 25,808,270 (GRCm39) V1218A probably damaging Het
Myo19 A G 11: 84,792,328 (GRCm39) K599R probably damaging Het
Neurl4 T C 11: 69,798,134 (GRCm39) M771T probably damaging Het
Nlrc4 A G 17: 74,753,936 (GRCm39) V149A probably benign Het
Nup133 A T 8: 124,641,935 (GRCm39) S843T probably benign Het
Or2y1c T C 11: 49,361,358 (GRCm39) C127R probably damaging Het
Or51k1 T C 7: 103,661,777 (GRCm39) N44S probably damaging Het
P3h2 A G 16: 25,811,412 (GRCm39) probably null Het
Piezo2 A T 18: 63,278,042 (GRCm39) Y287* probably null Het
Prob1 T C 18: 35,785,605 (GRCm39) Y883C probably damaging Het
Pxdn T A 12: 30,050,011 (GRCm39) H506Q probably benign Het
Ripor3 T C 2: 167,827,037 (GRCm39) D658G probably benign Het
Rufy1 T A 11: 50,301,434 (GRCm39) I333L probably benign Het
Selenok T A 14: 29,692,064 (GRCm39) V34E probably benign Het
Selplg T C 5: 113,957,787 (GRCm39) E173G possibly damaging Het
Septin10 A G 10: 59,016,943 (GRCm39) F194L probably damaging Het
Sptbn2 A T 19: 4,779,230 (GRCm39) probably null Het
St6galnac6 C T 2: 32,498,098 (GRCm39) P6S probably benign Het
Syngr2 T C 11: 117,704,296 (GRCm39) Y194H probably damaging Het
Thbs4 A G 13: 92,894,576 (GRCm39) I649T possibly damaging Het
Triobp T A 15: 78,850,816 (GRCm39) N323K probably benign Het
Tuba8 T A 6: 121,197,548 (GRCm39) L70Q probably damaging Het
Vmn2r61 A G 7: 41,949,478 (GRCm39) T633A probably benign Het
Zfp280b G T 10: 75,875,188 (GRCm39) V356L probably damaging Het
Zswim4 A T 8: 84,944,001 (GRCm39) V746D probably benign Het
Other mutations in Anks6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Anks6 APN 4 47,046,054 (GRCm39) missense probably damaging 0.98
IGL01886:Anks6 APN 4 47,044,850 (GRCm39) missense probably damaging 1.00
IGL02903:Anks6 APN 4 47,045,004 (GRCm39) missense probably damaging 1.00
PIT4131001:Anks6 UTSW 4 47,027,109 (GRCm39) missense probably damaging 1.00
R0632:Anks6 UTSW 4 47,033,167 (GRCm39) missense possibly damaging 0.95
R1220:Anks6 UTSW 4 47,025,767 (GRCm39) splice site probably benign
R1398:Anks6 UTSW 4 47,044,926 (GRCm39) missense possibly damaging 0.75
R1479:Anks6 UTSW 4 47,044,874 (GRCm39) missense probably damaging 1.00
R1519:Anks6 UTSW 4 47,027,152 (GRCm39) missense probably damaging 0.99
R1713:Anks6 UTSW 4 47,039,726 (GRCm39) missense probably benign 0.00
R1781:Anks6 UTSW 4 47,043,639 (GRCm39) missense possibly damaging 0.87
R1853:Anks6 UTSW 4 47,049,387 (GRCm39) missense probably benign 0.00
R2364:Anks6 UTSW 4 47,027,248 (GRCm39) missense possibly damaging 0.93
R3790:Anks6 UTSW 4 47,049,212 (GRCm39) missense probably damaging 0.97
R4432:Anks6 UTSW 4 47,044,905 (GRCm39) nonsense probably null
R4700:Anks6 UTSW 4 47,033,127 (GRCm39) missense possibly damaging 0.86
R4847:Anks6 UTSW 4 47,033,266 (GRCm39) missense probably benign
R4876:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4877:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4878:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4879:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4961:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4962:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4970:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4971:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R5092:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R5113:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R5389:Anks6 UTSW 4 47,038,900 (GRCm39) splice site probably benign
R5569:Anks6 UTSW 4 47,045,007 (GRCm39) missense probably damaging 1.00
R5857:Anks6 UTSW 4 47,039,736 (GRCm39) missense possibly damaging 0.92
R5977:Anks6 UTSW 4 47,035,748 (GRCm39) missense probably benign 0.11
R5978:Anks6 UTSW 4 47,049,252 (GRCm39) missense probably damaging 1.00
R6933:Anks6 UTSW 4 47,049,164 (GRCm39) missense probably benign 0.25
R7175:Anks6 UTSW 4 47,046,268 (GRCm39) splice site probably null
R7454:Anks6 UTSW 4 47,038,919 (GRCm39) missense unknown
R7874:Anks6 UTSW 4 47,049,275 (GRCm39) missense unknown
R8146:Anks6 UTSW 4 47,043,605 (GRCm39) missense unknown
R8437:Anks6 UTSW 4 47,030,705 (GRCm39) missense probably benign 0.00
R9454:Anks6 UTSW 4 47,016,789 (GRCm39) missense possibly damaging 0.86
R9462:Anks6 UTSW 4 47,033,142 (GRCm39) missense unknown
R9567:Anks6 UTSW 4 47,044,880 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCACTGTACAGGTGTCAC -3'
(R):5'- AGTGAAGACAAGCCAGCTCTTG -3'

Sequencing Primer
(F):5'- ACTGTACAGGTGTCACAGGCATC -3'
(R):5'- AAGCCAGCTCTTGCCTGC -3'
Posted On 2016-04-27