Incidental Mutation 'R4968:Fhad1'
ID384176
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4968 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141918307 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 326 (G326W)
Ref Sequence ENSEMBL: ENSMUSP00000036224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036701] [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably damaging
Transcript: ENSMUST00000036701
AA Change: G326W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036224
Gene: ENSMUSG00000051435
AA Change: G326W

DomainStartEndE-ValueType
coiled coil region 31 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105779
AA Change: G991W

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: G991W

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105780
AA Change: G991W

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: G991W

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137618
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141957658 missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141916067 splice site probably null
R5504_Fhad1_818 UTSW 4 141985535 missense probably benign
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
R8711:Fhad1 UTSW 4 141957613 missense probably benign 0.25
R8751:Fhad1 UTSW 4 141918823 missense probably benign 0.04
R8783:Fhad1 UTSW 4 141909092 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAAGTCTGTGTGTTCCCC -3'
(R):5'- TATTTAAAGGCCGCCTGTCCC -3'

Sequencing Primer
(F):5'- TGTGTTCCCCTGGGTGAC -3'
(R):5'- CCTCCCTGGGCATTTTGAG -3'
Posted On2016-04-27