Incidental Mutation 'R4968:Kcp'
ID384180
Institutional Source Beutler Lab
Gene Symbol Kcp
Ensembl Gene ENSMUSG00000059022
Gene Namekielin/chordin-like protein
SynonymsCrim2, KCP, LOC333088
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4968 (G1)
Quality Score213
Status Not validated
Chromosome6
Chromosomal Location29473162-29507952 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 29497629 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 519 (C519*)
Ref Sequence ENSEMBL: ENSMUSP00000099135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479] [ENSMUST00000161237]
Predicted Effect probably null
Transcript: ENSMUST00000078112
AA Change: C519*
SMART Domains Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: C519*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
Pfam:VWD 1214 1254 4.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000091391
AA Change: C519*
SMART Domains Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: C519*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1082 6.53e-9 SMART
VWC 1089 1142 1.05e-3 SMART
VWC 1149 1206 2.93e-11 SMART
Pfam:VWD 1213 1253 4.6e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101614
AA Change: C519*
SMART Domains Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: C519*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 8e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
VWD 1201 1362 6.09e-50 SMART
C8 1404 1479 1.55e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159479
SMART Domains Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
VWC 1 51 4.56e-1 SMART
VWC 54 110 1.98e-8 SMART
VWC 113 169 1.35e-1 SMART
VWC 172 228 5.77e-10 SMART
VWC 231 286 1.21e-3 SMART
VWC 289 353 6.53e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160181
SMART Domains Protein: ENSMUSP00000125699
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
VWC 18 74 1.24e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161237
SMART Domains Protein: ENSMUSP00000124097
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 60 92 N/A INTRINSIC
internal_repeat_1 94 117 8.56e-6 PROSPERO
internal_repeat_1 136 159 8.56e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162959
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Kcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Kcp APN 6 29482657 missense probably benign
IGL01344:Kcp APN 6 29498951 splice site probably null
IGL01404:Kcp APN 6 29496639 missense probably damaging 0.99
IGL01735:Kcp APN 6 29498879 missense probably damaging 1.00
IGL01776:Kcp APN 6 29497908 missense probably damaging 1.00
IGL02092:Kcp APN 6 29489032 critical splice donor site probably null
IGL02252:Kcp APN 6 29504549 missense probably damaging 1.00
IGL02690:Kcp APN 6 29484999 unclassified probably benign
IGL02817:Kcp APN 6 29496969 missense probably damaging 0.97
IGL03074:Kcp APN 6 29496631 missense probably damaging 1.00
P0045:Kcp UTSW 6 29498348 missense probably damaging 1.00
R0219:Kcp UTSW 6 29495785 missense probably damaging 1.00
R0355:Kcp UTSW 6 29496927 missense possibly damaging 0.89
R0738:Kcp UTSW 6 29490439 missense probably benign 0.24
R1111:Kcp UTSW 6 29485423 missense probably benign
R1304:Kcp UTSW 6 29501292 unclassified probably benign
R1663:Kcp UTSW 6 29498965 missense possibly damaging 0.68
R1808:Kcp UTSW 6 29505655 missense probably benign 0.05
R1907:Kcp UTSW 6 29497835 unclassified probably benign
R2030:Kcp UTSW 6 29489072 missense probably damaging 1.00
R2099:Kcp UTSW 6 29496165 nonsense probably null
R3411:Kcp UTSW 6 29482846 missense possibly damaging 0.68
R3982:Kcp UTSW 6 29484637 missense probably damaging 1.00
R3983:Kcp UTSW 6 29484637 missense probably damaging 1.00
R4223:Kcp UTSW 6 29482258 missense possibly damaging 0.55
R4377:Kcp UTSW 6 29493203 missense probably damaging 1.00
R4570:Kcp UTSW 6 29491848 nonsense probably null
R4624:Kcp UTSW 6 29482814 missense possibly damaging 0.94
R4694:Kcp UTSW 6 29493197 missense probably benign 0.29
R4750:Kcp UTSW 6 29484626 missense probably benign 0.03
R5053:Kcp UTSW 6 29496958 missense probably benign 0.01
R5067:Kcp UTSW 6 29492108 missense probably benign 0.06
R5253:Kcp UTSW 6 29498520 unclassified probably benign
R5418:Kcp UTSW 6 29504284 nonsense probably null
R6020:Kcp UTSW 6 29502864 missense probably benign 0.03
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6088:Kcp UTSW 6 29502632 missense probably benign
R6178:Kcp UTSW 6 29482888 missense possibly damaging 0.68
R6285:Kcp UTSW 6 29502365 missense probably benign 0.21
R6310:Kcp UTSW 6 29493258 missense probably damaging 0.98
R6369:Kcp UTSW 6 29484694 missense probably damaging 1.00
R6860:Kcp UTSW 6 29505720 missense probably benign 0.19
R6949:Kcp UTSW 6 29484612 splice site probably null
R6962:Kcp UTSW 6 29482840 missense probably benign 0.08
R7006:Kcp UTSW 6 29499170 missense probably damaging 1.00
R7138:Kcp UTSW 6 29491862 nonsense probably null
R7141:Kcp UTSW 6 29487512 nonsense probably null
R7153:Kcp UTSW 6 29499015 missense probably damaging 1.00
R7162:Kcp UTSW 6 29497200 intron probably null
R7334:Kcp UTSW 6 29485512 missense probably damaging 1.00
R7565:Kcp UTSW 6 29499187 missense probably damaging 1.00
R7671:Kcp UTSW 6 29496517 missense probably benign 0.02
R7766:Kcp UTSW 6 29496847 missense probably damaging 0.98
R7781:Kcp UTSW 6 29497765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACCTTGTGAGTTCCAGAG -3'
(R):5'- GTGATAGCTGCACCTACCAC -3'

Sequencing Primer
(F):5'- TTGTGTGGGACCAAGAACACTTAC -3'
(R):5'- CCACAGCCTGGTGTATGCTAATG -3'
Posted On2016-04-27