Incidental Mutation 'R4968:Zfp280b'
ID384198
Institutional Source Beutler Lab
Gene Symbol Zfp280b
Ensembl Gene ENSMUSG00000049764
Gene Namezinc finger protein 280B
SynonymsSuhw2, D10Jhu82e
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R4968 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76032650-76043234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 76039354 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 356 (V356L)
Ref Sequence ENSEMBL: ENSMUSP00000056340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061617] [ENSMUST00000218627]
Predicted Effect probably damaging
Transcript: ENSMUST00000061617
AA Change: V356L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056340
Gene: ENSMUSG00000049764
AA Change: V356L

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 29 37 N/A INTRINSIC
Pfam:DUF4195 53 227 1.3e-38 PFAM
ZnF_C2H2 297 318 3.65e1 SMART
ZnF_C2H2 334 357 9.46e0 SMART
ZnF_C2H2 364 387 8.22e-2 SMART
ZnF_C2H2 394 417 4.23e0 SMART
ZnF_C2H2 423 445 1.72e1 SMART
ZnF_C2H2 451 474 2.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218627
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that upregulates expression of MDM2, which negatively regulates p53 expression. This gene is highly expressed in prostate cancer cells, which leads to a reduction in p53 levels and an increase in growth of the cancer cells. Several transcript variants have been found for this gene, but only one of them is protein-coding. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Zfp280b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp280b APN 10 76039663 missense probably damaging 0.99
IGL02016:Zfp280b APN 10 76039111 missense possibly damaging 0.68
IGL02245:Zfp280b APN 10 76039363 missense probably benign
IGL03233:Zfp280b APN 10 76039769 missense probably damaging 1.00
R0864:Zfp280b UTSW 10 76038305 missense probably benign 0.00
R1501:Zfp280b UTSW 10 76039769 missense probably damaging 1.00
R1643:Zfp280b UTSW 10 76039610 missense probably damaging 1.00
R2004:Zfp280b UTSW 10 76038536 missense probably benign 0.00
R2024:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2025:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2027:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2064:Zfp280b UTSW 10 76039183 missense probably damaging 1.00
R3729:Zfp280b UTSW 10 76039102 missense probably benign 0.33
R4634:Zfp280b UTSW 10 76038829 missense probably benign 0.00
R4812:Zfp280b UTSW 10 76039090 missense probably benign 0.24
R5007:Zfp280b UTSW 10 76039214 missense probably damaging 1.00
R5123:Zfp280b UTSW 10 76039349 missense probably benign 0.02
R5503:Zfp280b UTSW 10 76039462 unclassified probably null
R5552:Zfp280b UTSW 10 76039663 nonsense probably null
R6954:Zfp280b UTSW 10 76039688 missense probably benign 0.36
R7299:Zfp280b UTSW 10 76038703 missense probably damaging 0.98
R7301:Zfp280b UTSW 10 76038703 missense probably damaging 0.98
R7485:Zfp280b UTSW 10 76039241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCCAGCTGCTTGAAAG -3'
(R):5'- TATGGCATCCCAGTTTTGAAGATC -3'

Sequencing Primer
(F):5'- CATCATTTGGAGCTCGAGA -3'
(R):5'- GGCATCCCAGTTTTGAAGATCTTAAG -3'
Posted On2016-04-27